ORFeome > dyrk1a ORF1 – XORFeome v1.0

dyrk1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dyrk1a
Gene ID: 1017110
Gene Page ID: 1017104
ORF Xenbase ID: 17273409

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110968
Original XGC clone length: 2253

Human orthology & disease relationships

NCBI Entrez ID: 1859
Ensembl gene IDs: ENSG00000157540
Directly associated (OMIM) disease MIM numbers: 614104
Indirectly associated (Lage, et al.) disease MIM numbers: 115150,125853,164400,191100,605407,606690

Library Location

Plate ID: GDExl11083
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ837192
dbEST ID: 79654894
Trimmed Sequence: ATGCATACAGGAGGAGAGACTTCAGCATGCAAACCATCATCTGTCCGGCTTGCACCATCCTTTTCATTCCATGCTGCCGGCCTTCAGATGGCTGGACAAATGTCCCATTCACATCAGCAGTACAGTGACCGCCATCAGCAGAACCTAAACGACCAACAAGCATCTGCCTTACCATACAATGACCAGACTCCGCAACCGTTGCCTAACCAGCGGCGGATGCCACAAACATTTCGCGATCCAGCCACAGCACCATTGAGAAAACTGTCAGTCGACTTGATCAAAACATACAAACATATTAATGAGGTCTACTATGCAAAAAAGAAACGGCGGCATCAGCAAGGACAAGGGGATGACTCCAGTCATAAGAAGGAGAGGAAGGTTTACAATGATGGCTATGATGATGACAACTACGACTATATTGTTAAAAATGGTGAAAAATGGATGGATAGATATGAAATCGATTCTTTAATTGGCAAAGGGTCATTCGGCCAGGTTGTAAAGGCATATGATCGCGTGGAGCAAGAGTGGGTGGCGATTAAAATTATAAAGAACAAGAAAGCTTTCTTAAACCAAGCCCAAATTGAAGTCCGGCTTCTCGAGCTGATGAACAAACATGACACGGAAATGAAGTACTATATCGTGCATTTAAAGCGGCATTTTATGTTCAGAAACCACCTTTTGTTTAGTGTTTGAAATGCTCTCGTACCAACCTCTAAAATTTACTGCGCAACACCAATTTTCCTTGGCGTTTCTCTCACCCTGAACCCAAAGTTTTGAAAAAGAAAAATTTGCCCTTCAACTTACTCCTTCC
Full Trace Sequence: CGCGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATACAGGAGGAGAGACTTCAGCATGCAAACCATCATCTGTCCGGCTTGCACCATCCTTTTCATTCCATGCTGCCGGCCTTCAGATGGCTGGACAAATGTCCCATTCACATCAGCAGTACAGTGACCGCCATCAGCAGAACCTAAACGACCAACAAGCATCTGCCTTACCATACAATGACCAGACTCCGCAACCGTTGCCTAACCAGCGGCGGATGCCACAAACATTTCGCGATCCAGCCACAGCACCATTGAGAAAACTGTCAGTCGACTTGATCAAAACATACAAACATATTAATGAGGTCTACTATGCAAAAAAGAAACGGCGGCATCAGCAAGGACAAGGGGATGACTCCAGTCATAAGAAGGAGAGGAAGGTTTACAATGATGGCTATGATGATGACAACTACGACTATATTGTTAAAAATGGTGAAAAATGGATGGATAGATATGAAATCGATTCTTTAATTGGCAAAGGGTCATTCGGCCAGGTTGTAAAGGCATATGATCGCGTGGAGCAAGAGTGGGTGGCGATTAAAATTATAAAGAACAAGAAAGCTTTCTTAAACCAAGCCCAAATTGAAGTCCGGCTTCTCGAGCTGATGAACAAACATGACACGGAAATGAAGTACTATATCGTGCATTTAAAGCGGCATTTTATGTTCAGAAACCACCTTTTGTTTAGTGTTTGAAATGCTCTCGTACCAACCTCTAAAATTTACTGCGCAACACCAATTTTCCTTGGCGTTTCTCTCACCCTGAACCCAAAGTTTTGAAAAAGAAAAATTTGCCCTTCAACTTACTCCTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATACAGGAGGAGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837191
dbEST ID: 79654893
Trimmed Sequence: CGAGCTTGCCACAGGACTCTGCTGAACACAAACTCCTGTCATGGGAGAGTCTTCTCGGTCAATCCCTTGCCTCATCGTTAATTGTCCTTCCGTTACGTAATGGCCAGGGCCTGTATTTGCAGAATATTGGTAATCTGGATGTCCAGTGATGCCAGTCTCTTGGCGAGGATTTGAATAGACAGTTAAATTAACATCCAAAGTTCCATTCTGTCCAAAGTCCAAGGTGTTAGCAGCCACAGGACGATTTTGGTAGGCCTGATTGCCTTGGTTGCCAGTAGAAGAGGAAGATGTTGAGGAAGAAGTAGTTGAGGAAGACAAGGATGTCATGGAGTGGTGGCTATTACCAATATCCATAGAATCCTGGGTGGAGGAGCTAGTTGATGGAGAATTGTAGATCCTGGTCCTCGTCCTGTTACTCAAGATATGCTGTCCATGGTGGTGATGGTGGTGGTGATGATGATGGTGGGAGGGNTTGGGAGGGTGGGGAAAAAAATTTTTTAGAAAAGAGGGGAGGTGAAAAAAAACTGTTTATGGGGAGGTGTGGGTGTGGGTAAATAAAGAAGAAGCTGGAGGGGAAAAGGGAGAATGTGGAATGGGTGTGAAGGGTGTTTATTGAGAAAAAACTTGGCTTTATTGAGAGGGGGGGGGCTGGCGTACAACACATGCAAAGGCGAGGGGGCATAGTTCGGATCGTCG
Full Trace Sequence: GGGAAAAAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGAGCTTGCCACAGGACTCTGCTGAACACAAACTCCTGTCATGGGAGAGTCTTCTCGGTCAATCCCTTGCCTCATCGTTAATTGTCCTTCCGTTACGTAATGGCCAGGGCCTGTATTTGCAGAATATTGGTAATCTGGATGTCCAGTGATGCCAGTCTCTTGGCGAGGATTTGAATAGACAGTTAAATTAACATCCAAAGTTCCATTCTGTCCAAAGTCCAAGGTGTTAGCAGCCACAGGACGATTTTGGTAGGCCTGATTGCCTTGGTTGCCAGTAGAAGAGGAAGATGTTGAGGAAGAAGTAGTTGAGGAAGACAAGGATGTCATGGAGTGGTGGCTATTACCAATATCCATAGAATCCTGGGTGGAGGAGCTAGTTGATGGAGAATTGTAGATCCTGGTCCTCGTCCTGTTACTCAAGATATGCTGTCCATGGTGGTGATGGTGGTGGTGATGATGATGGTGGGAGGGNTTGGGAGGGTGGGGAAAAAAATTTTTTAGAAAAGAGGGGAGGTGAAAAAAAACTGTTTATGGGGAGGTGTGGGTGTGGGTAAATAAAGAAGAAGCTGGAGGGGAAAAGGGAGAATGTGGAATGGGTGTGAAGGGTGTTTATTGAGAAAAAACTTGGCTTTATTGAGAGGGGGGGGGCTGGCGTACAACACATGCAAAGGCGAGGGGGCATAGTTCGGATCGTCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAGCTTGCCACAGGAC