ORFeome > e2f1 ORF1 – XORFeome v1.0

e2f1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: e2f1
Gene ID: 865484
Gene Page ID: 481740
ORF Xenbase ID: 17273433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129534
Original XGC clone length: 1281

Human orthology & disease relationships

NCBI Entrez ID: 1869
Ensembl gene IDs: ENSG00000101412
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,133239,151623,176270,211980,214150,216400,259500,260500,264300,275355,300367,302950,601675,608089,609048

Library Location

Plate ID: GDExl11086
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ837910
dbEST ID: 79655612
Trimmed Sequence: ATGTCCCAGGAGTTTGGGGTGACTTACAGCTGCAATGAAGGAGATTTGGGGGCTCTCTGGGAAGCTGGAACCTTCCAGGTGGCTGAACAGCAGATTGTTATTATATCCACCCCTGATGTCCCTGCTGAAGCTGCTGGAAACCCTGGTCTCAGTGAGGCAGAGTTGATGCTCTTTACCACCCCTCAGGGTCCTTCCACGTCGTATACTGCTCAGAGGCCCGCTCTTGGACGCCCACCGGTGAAGAGGAAGTTAGATTTGGAAACTGTATCCAGATATAGTCAAGATGGACTACAGACTCCCCGTGGGAAGGGCAAAAGACCTCTGAAAGCCGTGAAATCCCCAGGCGAGCGGTCTCGGTATGATACATCCCTGCATCTTACAACCAAACGTTTTCTGGAACTGCTAAGCCAGTCTCCAGATGGAGTAGTGGATCTGAACTGGGCTGCTCAGGTGCTGAATGTGCAGAAAAGGAGAATATACGACATAACCAATGTATTAGAAGGAATCAACTTAATCGCTAAAAAATCCAAAAACCACATACAATGGCTAGGGTATACATCATCTGTGGAATTCAGCAGCAGATACCAGAGTGTGTCGAAGGAGTGCCAGAATTTAGAGGACCAAGAGAAGCAGTTAGATGAACTTATTCACATGTGCCACACTCAGTTTGAAATTGTTTAAAGAAGATGAAATTCAGATTTATGGATATGTACCTTGTCAGGGACCTCCGAAACCATTCCAAATCCATCTGAAACCCAGGCTTTAAGGGTGGGGGAAGGTATTCCTCCCCGAAAACAGAAAAATTTT
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGAGTTTGGGGTGACTTACAGCTGCAATGAAGGAGATTTGGGGGCTCTCTGGGAAGCTGGAACCTTCCAGGTGGCTGAACAGCAGATTGTTATTATATCCACCCCTGATGTCCCTGCTGAAGCTGCTGGAAACCCTGGTCTCAGTGAGGCAGAGTTGATGCTCTTTACCACCCCTCAGGGTCCTTCCACGTCGTATACTGCTCAGAGGCCCGCTCTTGGACGCCCACCGGTGAAGAGGAAGTTAGATTTGGAAACTGTATCCAGATATAGTCAAGATGGACTACAGACTCCCCGTGGGAAGGGCAAAAGACCTCTGAAAGCCGTGAAATCCCCAGGCGAGCGGTCTCGGTATGATACATCCCTGCATCTTACAACCAAACGTTTTCTGGAACTGCTAAGCCAGTCTCCAGATGGAGTAGTGGATCTGAACTGGGCTGCTCAGGTGCTGAATGTGCAGAAAAGGAGAATATACGACATAACCAATGTATTAGAAGGAATCAACTTAATCGCTAAAAAATCCAAAAACCACATACAATGGCTAGGGTATACATCATCTGTGGAATTCAGCAGCAGATACCAGAGTGTGTCGAAGGAGTGCCAGAATTTAGAGGACCAAGAGAAGCAGTTAGATGAACTTATTCACATGTGCCACACTCAGTTTGAAATTGTTTAAAGAAGATGAAATTCAGATTTATGGATATGTACCTTGTCAGGGACCTCCGAAACCATTCCAAATCCATCTGAAACCCAGGCTTTAAGGGTGGGGGAAGGTATTCCTCCCCGAAAACAGAAAAATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGAGTTTGGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837909
dbEST ID: 79655611
Trimmed Sequence: CAAATCCAGAGCTGCGAGGCCACTAAAGTCACAGTCAAAGTTGAAAAGTTCAGCTGCACCTTCGCAGGTTTGCAATCCAAAGCTGTACTCCTGTGACGAAGTAGGCGACAGGCTGATGAACTCATTAGGGAGAAGGTCTGGCATAAAATCCCGGTGATGCAGGAGGTCAGAGGGAGAAAGTGGGAGACAATTCAAAGTATAATCAAGAGGTATTTCAGTCTCAGGTGGCAGGAACGGCTCTTGCATGTCAGACAGCAGCCCAAGCCCCATGTCCAGCATAGGGACAGAAGCAGGCAATTCCTCTTTCGGTTGGATAGGCAAGGGCCCTGCTTCGATAATGGACGAGGGTTCTGCTTGGCTAGTTTTTGTGGGACTTGTGACTGGGCTGCACACACCAGAACTGTCATCTGGACAGAGAAATACATCAATAGGTCCCTGTGTGCTTTTTAGAGACATCTGATAAGCCTCAGAAGGATCTGAAATACACATATCTGTCTCTGGAGGATACCTCACCACCATAAGCATGCGTTCAGATGGATCTGCAATGCTCCGAAGGTCCTGACAAGTTACATATCCATAATCATGACTCTCATCTTCTTTAAACAATTTCAACTGAGTGTTGCACATGTGAATAAGTTCATCTAACTGCTTCTCTTGGTCCTCTAAATTCTGGCACTCCTTCGACACACTCTGGTATCTGCTGCTGAATTCCACAGATGATGTATACCCTAGCCATTGTATGGTGGTTTGTTGGATTTTTTAACCAATAAATTTGATTCCTTCTAATACCTTTGGTTATGTGCGTAGATCCGCCCTTTTCTGCACATTCACCAACCTGAACCACCCCAATTCAGAATCACTACTCCCACCTGGAAACGGGCCTAAGCAGTTTCCAAAAAAACTTTTGGTTGATAAAAGGCGGGGGAGGTAATCGAAACGAAAAACCCCCCGCCCGGGGGGGGATTTGGGGGGGGTTTCAAAGGGCCTTTTTTCCCCTTCCGCCGCGGGGAAACTCCGGGAGGCCCACCTTTTAAAATAATTTTCGGAAAAAAAAGTGTTTCCAAAAAGCCAAAAATTTCCTCTTTTCCTCACCCCCGTGTGCCCCCCCCCCCCCACAAAACGCGGGCCCGCCCCCCCTGGGCGACCCCCGGACAAGGCAGCACACACAAATCGTCAAGAAAAAAAAGAAAAAC
Full Trace Sequence: GGGCGGGAATCAGCTTATGACCATGTAATACGACTCACTACTAGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAATCCAGAGCTGCGAGGCCACTAAAGTCACAGTCAAAGTTGAAAAGTTCAGCTGCACCTTCGCAGGTTTGCAATCCAAAGCTGTACTCCTGTGACGAAGTAGGCGACAGGCTGATGAACTCATTAGGGAGAAGGTCTGGCATAAAATCCCGGTGATGCAGGAGGTCAGAGGGAGAAAGTGGGAGACAATTCAAAGTATAATCAAGAGGTATTTCAGTCTCAGGTGGCAGGAACGGCTCTTGCATGTCAGACAGCAGCCCAAGCCCCATGTCCAGCATAGGGACAGAAGCAGGCAATTCCTCTTTCGGTTGGATAGGCAAGGGCCCTGCTTCGATAATGGACGAGGGTTCTGCTTGGCTAGTTTTTGTGGGACTTGTGACTGGGCTGCACACACCAGAACTGTCATCTGGACAGAGAAATACATCAATAGGTCCCTGTGTGCTTTTTAGAGACATCTGATAAGCCTCAGAAGGATCTGAAATACACATATCTGTCTCTGGAGGATACCTCACCACCATAAGCATGCGTTCAGATGGATCTGCAATGCTCCGAAGGTCCTGACAAGTTACATATCCATAATCATGACTCTCATCTTCTTTAAACAATTTCAACTGAGTGTTGCACATGTGAATAAGTTCATCTAACTGCTTCTCTTGGTCCTCTAAATTCTGGCACTCCTTCGACACACTCTGGTATCTGCTGCTGAATTCCACAGATGATGTATACCCTAGCCATTGTATGGTGGTTTGTTGGATTTTTTAACCAATAAATTTGATTCCTTCTAATACCTTTGGTTATGTGCGTAGATCCGCCCTTTTCTGCACATTCACCAACCTGAACCACCCCAATTCAGAATCACTACTCCCACCTGGAAACGGGCCTAAGCAGTTTCCAAAAAAACTTTTGGTTGATAAAAGGCGGGGGAGGTAATCGAAACGAAAAACCCCCCGCCCGGGGGGGGATTTGGGGGGGGTTTCAAAGGGCCTTTTTTCCCCTTCCGCCGCGGGGAAACTCCGGGAGGCCCACCTTTTAAAATAATTTTCGGAAAAAAAAGTGTTTCCAAAAAGCCAAAAATTTCCTCTTTTCCTCACCCCCGTGTGCCCCCCCCCCCCCACAAAACGCGGGCCCGCCCCCCCTGGGCGACCCCCGGACAAGGCAGCACACACAAATCGTCAAGAAAAAAAAGAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAATCCAGAGCTGCGAG