ORFeome > e2f6 ORF1 – XORFeome v1.0

e2f6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: e2f6
Gene ID: 6255254
Gene Page ID: 482438
ORF Xenbase ID: 17273451

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC133261
Original XGC clone length: 267

Human orthology & disease relationships

NCBI Entrez ID: 1876
Ensembl gene IDs: ENSG00000169016
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 145000

Library Location

Plate ID: GDExl11007
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ840211
dbEST ID: 79657913
Trimmed Sequence: ATGAAGACAGAAATTCAACATCAAGAAATAAAGATACCAACTAAAAAGTCGCTGAAATTGCCGAGGCCTCGCTTTGACGTCTCCTTGTTCTACTTGACTCGGAAGTTTGTGGACATAATCAAAGCTGCTCCGGACGGTATTGTGGATCTAAATGATGTTGCTACTATGCTGGGGGTGCGGAAAAGGAGAGTATATGACATTACCAATGTACTCGATGGGATCAACCTAATTCAGAAGAGGTCAAAAAACCATGTCCAGTGGATGTT
Full Trace Sequence: GGGGGGGTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGACAGAAATTCAACATCAAGAAATAAAGATACCAACTAAAAAGTCGCTGAAATTGCCGAGGCCTCGCTTTGACGTCTCCTTGTTCTACTTGACTCGGAAGTTTGTGGACATAATCAAAGCTGCTCCGGACGGTATTGTGGATCTAAATGATGTTGCTACTATGCTGGGGGTGCGGAAAAGGAGAGTATATGACATTACCAATGTACTCGATGGGATCAACCTAATTCAGAAGAGGTCAAAAAACCATGTCCAGTGGATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGAAAAAGACAAAAAAACTCAAAAGTTACAAAAAGGAAGACCGGGGAGTGAAAGAGACAAAAAATAAAAGGGACCATGGGGAATGGGGGTATCTGATTGGGGAGGGAAAGGGGCGCAAACCCCCCCCCAAACAAAAGGGTGGCCGGTGGATTCTTATTTGAAAAGCAGGGAGGAAGGGCCCAACCCGAAGGGGAAAAAAACCCCGGGTGGGGGCAAGAAGGGGGAGGGGGGAAAGGCGGGGTTTTGGGGCTGTGTTTAAGTGGGGTTCCTAAAACCCGTGGGACCCAACCCCCCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGACAGAAATTCAACATCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ840210
dbEST ID: 79657912
Trimmed Sequence: CATCCACTGGACATGGTTTTTTGACCTCTTCTGAATTAGGTTGATCCCATCGAGTACATTGGTAATGTCATATACTCTCCTTTTCCGCACCCCCNGCATAGTAGCAACATCATTTAGATCCACAATACCGTCCGGAGCAGCTTTGATTATGTCCACAAACTTCCGAGTCAAGTAGAACAAGGAGACGTCAAAGCGAGGCCTCGGCAATTTCAGCGACTTTTTAGTTGGTATCTTTATTTCTTGATGTTGAATTTCTGTCTTCATGG
Full Trace Sequence: GGGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATCCACTGGACATGGTTTTTTGACCTCTTCTGAATTAGGTTGATCCCATCGAGTACATTGGTAATGTCATATACTCTCCTTTTCCGCACCCCCNGCATAGTAGCAACATCATTTAGATCCACAATACCGTCCGGAGCAGCTTTGATTATGTCCACAAACTTCCGAGTCAAGTAGAACAAGGAGACGTCAAAGCGAGGCCTCGGCAATTTCAGCGACTTTTTAGTTGGTATCTTTATTTCTTGATGTTGAATTTCTGTCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGAACATCAATAAACAACATCATTTAATAAAAAACGGCAAATGGGGCACGGCAAAGAACAAAAAAAACAAAGGGCTAACTCGGAACAGGGGGTATTCGCTTTAATCAGGGTATAGGAACAAAGCATCCAACAAAAAAAAAGAGAGCGTGTTTGGATTTTATGAAATAGTGGAAAAAGCGCCAGCCCCCCCGGGGGACACAAAACAAAACCCCGCCCGGGGGAAGGGGAGAGGGAGGGGGGTTTTTGGGCTCTTAATGCGGTTTTTTTTCCGTATATATTATGGATAAACGGTCTCCCGCCCGCACACCCGAGCCCCCCCCGCGGGGGTCTTCTATGGGGGTTGGGATTGGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCCACTGGACATGGTT