ORFeome > e2f7 ORF1 – XORFeome v1.0

e2f7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: e2f7
Gene ID: 1018449
Gene Page ID: 1018444
ORF Xenbase ID: 17273457

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125980
Original XGC clone length: 2604

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCTCGGGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGTAACGACCTGTTTGAGGCTGCTGTAGATCAAGGCAAAATTTCTTCCCTCCCCAACACCATCACCGCATCAAGAATGCGTCCTGTTCCCAAAGATGACTTCCTCGAAACTCCGAGTACTCCAGATGTGTCCTCTTCCTTGAAACAACCAACGACCCCAACCACAACTTCCAGCTCTGCACCAAGGAAACTGGATATCTACAGCAGTGTACTCAACTTGCCAACTTTCTTGTACTACGTTGGCATTATAAGAAACCATTGCTTATCATTTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCATCCTTCTGATATCCCCTATAGTGATTCATAATACCTGTTCATATCATTTTTCCTGGCCGCTCTGGTCACTGTACAACAAACTACAATAATTCAATGACATCCAGCTAATGTCCCCAAAAATGAGTCATAATAGCTGGATCCAACTATCCCCCGGCCGCAATAGAGGACGTCGCTGTTCCACTTAACCAAAGAAAACAACCGCTCCCCCCCAATATAGAAAGATGAAAAAAGGACCCGAGTTAATGGTTCCCTGGTTGCCGGGGGAAGCGGTTAACGCAAAAGAAAAACGCTCCACCCCCCTCCCGAGGACAAAATTCCGGGCCAAACCACACCGCAGTGAAGGAACCACACCCGCACCTGTTCCCCAACTTGACTATACACCTTTTTGTGTAAGGCAAAAAGGGGGGATCCCCGCGCATGGTCATAAAACAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTAACGACCTGTTTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838143
dbEST ID: 79655845
Trimmed Sequence: GTTGACTACACTGCTGTCTATATCCAGTTTCCTTTGTGCAGAGCTGGAAGTTCTGGTTTGGGTCCTTTGTCGTTTCCTGGAAGAGGACACATCTAGACTACCTGGAGTTTTGAAGAAGGCATCTTTGTGAATTGGACGAATGCTTTTTGGAGTTGAGGGTGTTGGCGACTTATGCAATTTTGCATTGTGCACTGACTGACTCAAACAGGTCGGTAACTCCGTGG
Full Trace Sequence: CGGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGACTACACTGCTGTCTATATCCAGTTTCCTTTGTGCAGAGCTGGAAGTTCTGGTTTGGGTCCTTTGTCGTTTCCTGGAAGAGGACACATCTAGACTACCTGGAGTTTTGAAGAAGGCATCTTTGTGAATTGGACGAATGCTTTTTGGAGTTGAGGGTGTTGGCGACTTATGCAATTTTGCATTGTGCACTGACTGACTCAAACAGGTCGGTAACTCCGTGGTGCCAACTTTTTTGTACCAAGATGGCATTATAAAACACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGCCCTATCTTAACACTATTGGACATTTTAAAACACCATGTCAATCCATTATGTGAAACGAACAGGTCAATATCAGTCAAAGGCTGCTCCTTAAATGGCACCGCGCCGCAATCATAAACAGCAATTGGCATTCACCAAACACAAGGAACGCACTATCGGTACGGATATGGAATGGGGAAAGGAAACATTCCGAAAGTAGGCGGTCTTACGGTGCCGGGAGGTGGTCTTGGTCATTGGAGAATAGCGGGCTCCGGGGGGGGGTAAAAAAGGTATTCGGCGGTGTTTTTCTTTATGGAGGATTGGGGGGTGGGACGCGCGGTCCGGGGGCGCGGGAAATGAGGACGAATTCATAGGCGGTGAGAAGAGGAGAAATTGGATGGTGTTATATGATGGAAGAGAAAAACCCCGGGTNTCATGGAGGCGAAACCAACCAGAACACCCAAAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGACTACACTGCTGTCT