ORFeome > eaf2 ORF1 – XORFeome v1.0

eaf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eaf2
Gene ID: 5796139
Gene Page ID: 5796120
ORF Xenbase ID: 17273475

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060327
Original XGC clone length: 756

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ824812
dbEST ID: 79642514
Trimmed Sequence: ATGAACGGAGCAGCCTGTCCACTGTTTGATACCAAGGAGAGGCCATTGGTGCTCGGGGAGAGCTTCGAGAAGCAGCCAAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCATCTATTGATACCTCCTGTGAGGGGAACCTGGAAGCGGGCAAAGGAGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACTCCGGTTACTGTTTTCAAAGGTTCGAAAAGGCCATACCTGAGGGAATGTATCTTGATCGTGAATCATGACACGGGGGAATGTCGGCTGGAGAAATTAAGCAGCAATATTAGTGTAAAAAAAACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCCTGGAGCAGCAACAGCAGCAAATGCGCAATACCAGCAAAACACCCAACAGTGCCAAAAACTCTTCCTCACCCATGGAGAAAATGTCTCCGGCGTCCCCAATGGATGATATAGAGAGGGAACTAATGGCAGAAGCCAGTGTTATTGACCAAATGAGCAGTTCCGACAGTTCTTCGGAGTCCAAGAGCTCCTCCTCCAGTAGTGATGACAGCTCCNGTGATTCTGAGGATGAGAAAAACAAGTCGTCCCACTCCAAGCAGCTACCGCAGAGACATCACTCGGGATCGAGCACAGAGAGTGTGCACAAGTCTCANGACACGGGGGGGCAGATGATGAGTACTTTGCGTAATGACTTACAGCTCAGCGAATCCGGGGAGCGACAGTGACAATTTGCCCACTTTTCTTGTACAAAGGTGGGCATTAATAAGAAAGCATTGCCCTTATCCATTTTTGTTTGCA
Full Trace Sequence: CAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGGAGCAGCCTGTCCACTGTTTGATACCAAGGAGAGGCCATTGGTGCTCGGGGAGAGCTTCGAGAAGCAGCCAAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCATCTATTGATACCTCCTGTGAGGGGAACCTGGAAGCGGGCAAAGGAGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACTCCGGTTACTGTTTTCAAAGGTTCGAAAAGGCCATACCTGAGGGAATGTATCTTGATCGTGAATCATGACACGGGGGAATGTCGGCTGGAGAAATTAAGCAGCAATATTAGTGTAAAAAAAACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCCTGGAGCAGCAACAGCAGCAAATGCGCAATACCAGCAAAACACCCAACAGTGCCAAAAACTCTTCCTCACCCATGGAGAAAATGTCTCCGGCGTCCCCAATGGATGATATAGAGAGGGAACTAATGGCAGAAGCCAGTGTTATTGACCAAATGAGCAGTTCCGACAGTTCTTCGGAGTCCAAGAGCTCCTCCTCCAGTAGTGATGACAGCTCCNGTGATTCTGAGGATGAGAAAAACAAGTCGTCCCACTCCAAGCAGCTACCGCAGAGACATCACTCGGGATCGAGCACAGAGAGTGTGCACAAGTCTCANGACACGGGGGGGCAGATGATGAGTACTTTGCGTAATGACTTACAGCTCAGCGAATCCGGGGAGCGACAGTGACAATTTGCCCACTTTTCTTGTACAAAGGTGGGCATTAATAAGAAAGCATTGCCCTTATCCATTTTTGTTTGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGAGCAGCCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830183
dbEST ID: 79647885
Trimmed Sequence: ATCGTCACTGTCGCTCCCGGATTCGCTGAGCTGTAAGTCATTACGCAAAGTACTCATCATCTGCCCCCCGTTGTCCTGAGACTTGTGCACACTCTCTGTGCTCGATCCCGAGTGATGTCTCTGCGGTAGCTGCTTGGAGTGGGACGACTTGTTTTTCTCATCCTCAGAATCACTGGAGCTGTCATCACTACTGGAGGAGGAGCTCTTGGACTCCGAAGAACTGTCGGAACTGCTCATTTGGTCAATAACACTGGCTTCTGCCATTAGTTCCCTCTCTATATCATCCATTGGGGACGCCGGAGACATTTTCTCCATGGGTGAGGAAGAGTTTTTGGCACTGTTGGGTGTTTTGCTGGTATTGCGCATTTGCTGCTGTTGCTGCTCCAGGCGGGACTGGATCTTGCTGCTTCCTTCAGCCCTGGTTTTTTTTACACTAATATTGCTGCTTAATTTCTCCAGCCGACATTCCCCCGTGTCATGATTCACGATCAAGATACATTCCCTCAGGTATGGCCTTTTCGAACCTTTGAAAACAGTAACCGGAGTGGTGGATCCCTTCATGTTGGGCAGAGTGATGGTCACCTGTTCTCCTTTGCCCGCTTCCAGGGTTCCCCTCACAGGAGGTATCAATAGATGCCGGCTTGAAATCATAACGGGAATGTGTGGTACCCGCTTCTTGCCCGGCTTCTCGAAGCTCTCCCCCAAGCCCCATGGGCCCTCTCCCTGGGGATTTCAAACAAAGGAAAAAGGGCGGGCCT
Full Trace Sequence: GGCACGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCGTCACTGTCGCTCCCGGATTCGCTGAGCTGTAAGTCATTACGCAAAGTACTCATCATCTGCCCCCCGTTGTCCTGAGACTTGTGCACACTCTCTGTGCTCGATCCCGAGTGATGTCTCTGCGGTAGCTGCTTGGAGTGGGACGACTTGTTTTTCTCATCCTCAGAATCACTGGAGCTGTCATCACTACTGGAGGAGGAGCTCTTGGACTCCGAAGAACTGTCGGAACTGCTCATTTGGTCAATAACACTGGCTTCTGCCATTAGTTCCCTCTCTATATCATCCATTGGGGACGCCGGAGACATTTTCTCCATGGGTGAGGAAGAGTTTTTGGCACTGTTGGGTGTTTTGCTGGTATTGCGCATTTGCTGCTGTTGCTGCTCCAGGCGGGACTGGATCTTGCTGCTTCCTTCAGCCCTGGTTTTTTTTACACTAATATTGCTGCTTAATTTCTCCAGCCGACATTCCCCCGTGTCATGATTCACGATCAAGATACATTCCCTCAGGTATGGCCTTTTCGAACCTTTGAAAACAGTAACCGGAGTGGTGGATCCCTTCATGTTGGGCAGAGTGATGGTCACCTGTTCTCCTTTGCCCGCTTCCAGGGTTCCCCTCACAGGAGGTATCAATAGATGCCGGCTTGAAATCATAACGGGAATGTGTGGTACCCGCTTCTTGCCCGGCTTCTCGAAGCTCTCCCCCAAGCCCCATGGGCCCTCTCCCTGGGGATTTCAAACAAAGGAAAAAGGGCGGGCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGTCACTGTCGCTCC