ORFeome > echs1 ORF1 – XORFeome v1.0

echs1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: echs1
Gene ID: 5945929
Gene Page ID: 5945791
ORF Xenbase ID: 17273529

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123285
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID: 1892
Ensembl gene IDs: ENSG00000127884
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 201450,201460,203750,231530,231670,242100,245050,248600,255110,255120,264470,300194,300387,300438,600649,602398,604387,606054,608836,609015,609016,609975

Library Location

Plate ID: GDExl11084
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ837551
dbEST ID: 79655253
Trimmed Sequence: ATGGCGATGATTGGCAAAGCAATGCTTGTCCCTCTGTGTCCCATCCGTCAGTATCTTCGTAGAGGCTACAGTGCTGGCCCAGCTTTTCAATACATACTTGTGGAGAGGAAAGGGCAACATCACAATGTTGGTCTGATCCGTCTGAACCGACCAAAGGCTTTGAATGCATTGTGTGATGGATTGATGACAGAGCTCAATCAGGCTTTGGACACTTTTGAGGAAGACCCAAACATTGGTGCCATTGTTATTACTGGTAGTGAAAAGGCATTTGCTGGGCTTGTGAGCAAAGTGCACCCTGTGGATAGCGTAGTAGATCAGGCCATTATCTGTGGGGAGAAGATTTCTAGAAACTCCAAGCTGATTGTGTCAATCGCAAAGGAGGCTGTCAGTGGAGCTTTTGAGCTGTCTTTGGCAGAAGGCAACAGGCTGGAGAAAAGGCTGTTTCATTCAACATTTGCTACAGATGACCGTAAAGAAGGAATGACAGCCTTTGTGGAGAAAAGAAAAGCAAACTTCACAGATAAATT
Full Trace Sequence: GGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGATGATTGGCAAAGCAATGCTTGTCCCTCTGTGTCCCATCCGTCAGTATCTTCGTAGAGGCTACAGTGCTGGCCCAGCTTTTCAATACATACTTGTGGAGAGGAAAGGGCAACATCACAATGTTGGTCTGATCCGTCTGAACCGACCAAAGGCTTTGAATGCATTGTGTGATGGATTGATGACAGAGCTCAATCAGGCTTTGGACACTTTTGAGGAAGACCCAAACATTGGTGCCATTGTTATTACTGGTAGTGAAAAGGCATTTGCTGGGCTTGTGAGCAAAGTGCACCCTGTGGATAGCGTAGTAGATCAGGCCATTATCTGTGGGGAGAAGATTTCTAGAAACTCCAAGCTGATTGTGTCAATCGCAAAGGAGGCTGTCAGTGGAGCTTTTGAGCTGTCTTTGGCAGAAGGCAACAGGCTGGAGAAAAGGCTGTTTCATTCAACATTTGCTACAGATGACCGTAAAGAAGGAATGACAGCCTTTGTGGAGAAAAGAAAAGCAAACTTCACAGATAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAACCTGTTTTCAAAAAAAAAATAAAAAATATCTATACTTAATTTGATTTTGAAAAGTGACCGCCCCCCAAAAAAAAGGGCCCTCTTCTCTTCCCCCCCCCTTCTTCGTTTTTGTGTTTTTATCTGTTAGAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGATGATTGGCAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837550
dbEST ID: 79655252
Trimmed Sequence: TTTATCTGTGAAGTTTGCTTTTCTTTTCTCCACAAAGGCTGTCATTCCTTCTTTACGGTCATCTGTAGCAAATGTTGAATGAAACAGCCTTTTCTCCAGCCTGTTGCCTTCTGCCAAAGACAGCTCAAAAGCTCCACTGACAGCCTCCTTTGCGATTGACACAATCAGCTTGGAGTTTCTAGAAATCTTCTCCCCACAGATAATGGCCTGATCTACTACGCTATCCACAGGGTGCACTTTGCTCACAAGCCCAGCAAATGCCTTTTCACTACCAGTAATAACAATGGCACCAATGTTTGGGTCTTCCTCAAAAGTGTCCAAAGCCTGATTGAGCTCTGTCATCAATCCATCACACAATGCATTCAAAGCCTTTGGTCGGTTCAGACGGATCAGACCAACATTGTGATGTTGCCCTTTCCTCTCCACAAGTATGTATTGAAAAGCTGGGCCAGCACTGTAGCCTCTACGAAGATACTGACGGATGGGACACAGAGGGACAAGCATTGCTTTGCCAATCATCGCCCTGG
Full Trace Sequence: GGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATCTGTGAAGTTTGCTTTTCTTTTCTCCACAAAGGCTGTCATTCCTTCTTTACGGTCATCTGTAGCAAATGTTGAATGAAACAGCCTTTTCTCCAGCCTGTTGCCTTCTGCCAAAGACAGCTCAAAAGCTCCACTGACAGCCTCCTTTGCGATTGACACAATCAGCTTGGAGTTTCTAGAAATCTTCTCCCCACAGATAATGGCCTGATCTACTACGCTATCCACAGGGTGCACTTTGCTCACAAGCCCAGCAAATGCCTTTTCACTACCAGTAATAACAATGGCACCAATGTTTGGGTCTTCCTCAAAAGTGTCCAAAGCCTGATTGAGCTCTGTCATCAATCCATCACACAATGCATTCAAAGCCTTTGGTCGGTTCAGACGGATCAGACCAACATTGTGATGTTGCCCTTTCCTCTCCACAAGTATGTATTGAAAAGCTGGGCCAGCACTGTAGCCTCTACGAAGATACTGACGGATGGGACACAGAGGGACAAGCATTGCTTTGCCAATCATCGCCCTGGTGCCAACTTTTTTGTACAAAATTGGCATTAATAAAAAGCATTGCTCATCAATTTGTTGCAACCAACAAGTCACTATCAGTTAAAATAAAAACCATTATTTTGGGGCGCAAAAAAAAAAAAAAATCAATCATTTAAACTTTACCATGACTGGGACCCCGCGCCAAAAAAAAAACGCCCCCCTCCTTTCCCCCTCCGGCTGTGGTCGTGGGTGGGGGTATTGGGGGGGGGAAGAAAGAAAGGGAGAAAACACAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATCTGTGAAGTTTGCTTT