ORFeome > eci2 ORF1 – XORFeome v1.0

eci2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eci2
Gene ID: 961249
Gene Page ID: 961245
ORF Xenbase ID: 17273541

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC106604
Original XGC clone length: 1077

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ837744
dbEST ID: 79655446
Trimmed Sequence: ATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCCAAGCCTCTAGTTTGCCGTTGTAAATGGGCCAACAACTGGGATCTCTGTGAATAAATTAGGATTATTTTAATCTGTGTATGCCACTGACCGTGCCACATTTCCACACTCCTTTCCCCCCGCTGGGAACGAAATCCGAAAAG
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAAGTACATCAGGAAGACTTTGAAAAAGCACAAAGTAATCTGAAGTTATTGAAGAATGATCCCGGCAATGAAGTAAAACTGAAACTGTATGCATTGTTTAAGCAGGCTACACAGGGACCTTGTAACGTATCTAAACCAGGTATGTTGGACTTTGTTAATAAAGTGAAATGGGACGCCTGGAATTCTTTAGGAAGTTTGTCAAAGGATGACGCAAGACAGTCCTATGTGGAACTTGTTTCCAGTTTGGTGTCTTCTGAATCTCCCACCAAAAATAATACAGAGCCAAGTATAGGCCATAAGATGTATGAAACTATTCAGGTTTCCTGTGAGGACCGTATTACCAAAATATTTCTAAATCGTCCAGAAAAGAAAAATGCTATTACTCTTAAGATGTATGAGGAAATTGGAAAAGCGTTGGAAGAAGCTGGCAAAGATGAATCTGTTTTTGCTGTCTTATCTGGTGTTGGCGATTACTTCTGCAGTGGCAATGATTTAAACAATTTTACCAACATCCCACCAGAAGGGAAAGAAAAGATGGCAAATGATAGTGCAGACTTGTTAGAGGCATTTGTTAGTAAATTCATTGATTTTCCCAAGCCTCTAGTTTGCCGTTGTAAATGGGCCAACAACTGGGATCTCTGTGAATAAATTAGGATTATTTTAATCTGTGTATGCCACTGACCGTGCCACATTTCCACACTCCTTTCCCCCCGCTGGGAACGAAATCCGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAGTACATCAGGAAGACTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837743
dbEST ID: 79655445
Trimmed Sequence: CAATTTAGCTCTATTTTGGAAGAAGCTAATGATGGCATTCATGCACTCTTCTGATAACCATCTTTCCTTAAGGCGTTCACACTCTTGAATATTTACAGCATGAAGTTTTTCCTTTTCATTGACACGAATTAGCTGCTTGGAGAAGGCCAGTGAATTTTTAGGCAGGGTACCATATTCCTTAAGCCTTTCCCATACTTCTTTTTGGAAAGAACTGTCAGGGAAAACTTCAGTTACCAGTCCTAAATTGCAAGCTTCATGTGCTGTCAACTTCTTGTTGAAAAGAAGCATCTCTGTGGCTTTTCCTAAACCCATCATTCTAGGAAAGGTGTAAGAAGAACAACCTTCTGGACTCTGTCCCAGCTGGCTGAATGGAGTGTGGAATGTGGCACGATCAGTTGCATACACAAGATCAAATAATCCTAATATAGTCACAGAGATCCCAGTTGCTGGCCCATTTACAACGGCGACTACAGGCTTTGGAAAATCAATGAATTTACTAACAAATGCCTCTAACAAGTCTGCACTATCATTTGCCATCTTTTCTTTCCCTTCTGGTGGGATGTTGGTAGAATTGTTTAGATCATTGCCACTGCACAAGTAATCGCCAACACCAGATAAGACAGCGAAAACACATTCATCTTTGCCAGCTTCTTCCAACGCTTTTCCCATTTCCTCATACATCTTAAGAGTAATGAGAATTTTCTTTTCTGGACGAGTTAGAAATAAATAGATAATACGGGCCTCGGGGCAAAGCTGAGAAATTACATACGTCTTAAGAGCCTATAGGGGGCTCGGGGGTGTGTTTTGGTGGGAGGAGGGGGAGAACACAAAAAAAGGAAAGGGGGGAGCAAAGAAGGGGCGGGGCGGGGCGCGGGATAAAAATACGAAAAAAAATCAAGAGGGTCCGATTGCGGTTATTTGTAGAAGAACAAGGAGAAGGGGGTGGAAAATAAGTGGAAAAAACCGGCGGCGGGGGCGGGGGTGGACAAAGGGAGAACAAAAAGGGGAGTCTCTTGTCTTTTGCCGGGGGCGGGTGGGGGGGGGGAATAGGGGAGGAATTTTTATAATTAAGGTATAAAGGGGTTCCGGAGAACACCAAGTCAGGGGGGGGGGGGCGAGGGGGGTGTGGGGGGGGGGGGTGGAGGNGGAAAAAAAGAGAAAAAAAAAAAAAAAA
Full Trace Sequence: GGCAGGGCAACAGCCACTGAACANAGTAAAACGAACCACTAGACGGGGAAAACAGCCAGGAGGGCAAAAATGATTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATTTAGCTCTATTTTGGAAGAAGCTAATGATGGCATTCATGCACTCTTCTGATAACCATCTTTCCTTAAGGCGTTCACACTCTTGAATATTTACAGCATGAAGTTTTTCCTTTTCATTGACACGAATTAGCTGCTTGGAGAAGGCCAGTGAATTTTTAGGCAGGGTACCATATTCCTTAAGCCTTTCCCATACTTCTTTTTGGAAAGAACTGTCAGGGAAAACTTCAGTTACCAGTCCTAAATTGCAAGCTTCATGTGCTGTCAACTTCTTGTTGAAAAGAAGCATCTCTGTGGCTTTTCCTAAACCCATCATTCTAGGAAAGGTGTAAGAAGAACAACCTTCTGGACTCTGTCCCAGCTGGCTGAATGGAGTGTGGAATGTGGCACGATCAGTTGCATACACAAGATCAAATAATCCTAATATAGTCACAGAGATCCCAGTTGCTGGCCCATTTACAACGGCGACTACAGGCTTTGGAAAATCAATGAATTTACTAACAAATGCCTCTAACAAGTCTGCACTATCATTTGCCATCTTTTCTTTCCCTTCTGGTGGGATGTTGGTAGAATTGTTTAGATCATTGCCACTGCACAAGTAATCGCCAACACCAGATAAGACAGCGAAAACACATTCATCTTTGCCAGCTTCTTCCAACGCTTTTCCCATTTCCTCATACATCTTAAGAGTAATGAGAATTTTCTTTTCTGGACGAGTTAGAAATAAATAGATAATACGGGCCTCGGGGCAAAGCTGAGAAATTACATACGTCTTAAGAGCCTATAGGGGGCTCGGGGGTGTGTTTTGGTGGGAGGAGGGGGAGAACACAAAAAAAGGAAAGGGGGGAGCAAAGAAGGGGCGGGGCGGGGCGCGGGATAAAAATACGAAAAAAAATCAAGAGGGTCCGATTGCGGTTATTTGTAGAAGAACAAGGAGAAGGGGGTGGAAAATAAGTGGAAAAAACCGGCGGCGGGGGCGGGGGTGGACAAAGGGAGAACAAAAAGGGGAGTCTCTTGTCTTTTGCCGGGGGCGGGTGGGGGGGGGGAATAGGGGAGGAATTTTTATAATTAAGGTATAAAGGGGTTCCGGAGAACACCAAGTCAGGGGGGGGGGGGCGAGGGGGGTGTGGGGGGGGGGGGTGGAGGNGGAAAAAAAGAGAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATTTAGCTCTATTTTGGAA