ORFeome > edn1 ORF1 – XORFeome v1.0

edn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: edn1
Gene ID: 6252933
Gene Page ID: 491327
ORF Xenbase ID: 17273595

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124884
Original XGC clone length: 666

Human orthology & disease relationships

NCBI Entrez ID: 1906
Ensembl gene IDs: ENSG00000078401
Directly associated (OMIM) disease MIM numbers: 612798,615706
Indirectly associated (Lage, et al.) disease MIM numbers: 142623,277580,600155,600501

Library Location

Plate ID: GDExl11092
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ838835
dbEST ID: 79656537
Trimmed Sequence: ATGGACCTACAAATGATTTTTTCTCTGCTGGTGGTACTTGTGCAAGGAGTCAGTGCAACAGAGTCTCTCAGTGACAGCGCCACGCTCGCTAACCAGCCCCCTGCACCAACTGTACAGACGCACTCACAGCGCTCATCTGGCGCCCCCTGGCGACCACGTAGGGTTAAACGTTGTTCCTGTTCTTCCTTAATGGATAAAGAGTGTGTCTACTTCTGCCACTTGGACATCATATGGATCAACACTCCTGAGAGAACAGTACCGTATGGTCTTGGAGGGCCCCGCATGAAACGGGCATTGCAGGACACTGACCAAGAGAAACTCCTTGAGCCTGCAGGCAGGTGTGTGTGTGCCAAGCGTAAAGACAAAAAATGTATGGACTTCTGCCAAGCAACAGCAGAGCCCAGCGTTCAGCCATCTGTTGCCAAAGACAGAAGACAAGTTCAGCAGGCCACAAAGTGCCTTGGCCTCAGGCTTGGACAGCAGTGCATTCAAAAACAACATCACAGAAACAAGGTGAATGAAAGATCAGAAAACATCAAGCAGTCCATTAAGAATTCCTTTACTTTTGCCAGCCTAGTGAAAAAGCAAATTGAGACAAAAAAACCTCCAATCACTGGGAGCATGAAAATGGGGTGGGAGGGAAACACAAAAAACAAAATCCTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACCTACAAATGATTTTTTCTCTGCTGGTGGTACTTGTGCAAGGAGTCAGTGCAACAGAGTCTCTCAGTGACAGCGCCACGCTCGCTAACCAGCCCCCTGCACCAACTGTACAGACGCACTCACAGCGCTCATCTGGCGCCCCCTGGCGACCACGTAGGGTTAAACGTTGTTCCTGTTCTTCCTTAATGGATAAAGAGTGTGTCTACTTCTGCCACTTGGACATCATATGGATCAACACTCCTGAGAGAACAGTACCGTATGGTCTTGGAGGGCCCCGCATGAAACGGGCATTGCAGGACACTGACCAAGAGAAACTCCTTGAGCCTGCAGGCAGGTGTGTGTGTGCCAAGCGTAAAGACAAAAAATGTATGGACTTCTGCCAAGCAACAGCAGAGCCCAGCGTTCAGCCATCTGTTGCCAAAGACAGAAGACAAGTTCAGCAGGCCACAAAGTGCCTTGGCCTCAGGCTTGGACAGCAGTGCATTCAAAAACAACATCACAGAAACAAGGTGAATGAAAGATCAGAAAACATCAAGCAGTCCATTAAGAATTCCTTTACTTTTGCCAGCCTAGTGAAAAAGCAAATTGAGACAAAAAAACCTCCAATCACTGGGAGCATGAAAATGGGGTGGGAGGGAAACACAAAAAACAAAATCCTTGCCAACTTTCTTGTACAAAGTTGGCTTTTAAAAAAAACATTGCTAAACAATTTGTGGCAACCAACAGGGGCACTATCAGTCCAAAAGAAAACCATTAATTTCGCACCCCGCCTAGAAATCCCCGCGATNGTGAGTTCCAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCTACAAATGATTTTTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838834
dbEST ID: 79656536
Trimmed Sequence: TGATGTTGTCTTTCTGTGTTTCCATACACCCCAGTTTTTATGCATCCAGTGATGTGAGGTTTCTCTTGTCTCACTGTGCTTTTTCATTAGGCTGGCAAAAGTAAAGGAATTCTTAATGGACTGCTTGATGCTTTCTGATCTTTTCATCACCTTGTTTCTGTGATGTTGTTTTTGAATGCACTGCTGTCCAAGCCTGAGGCCAAGGCACTTTGTGGCCTGCTGAACTTGTCTTCTGTCTTTGGCAACAGATGGCTGAACGCTGGGCTCTGCTGTTGCTTGGCAGAAGTCCATACATTTCTTGTCTTTACGCTTGGCACACACACACCTGCCTGCAGGCTCAAGGAGTTTCTCTTGGTCAGTGTCCTGCAATGCCCGTTTCATGCGGGGCCCTCCAAGACCATACGGTACTGTTCTCTCAGGAGTGTTGATCCATATGATGTCCAAGTGGCAGAAGTAGACACACTCTTTATCCATTAAAGAAGAACAAGAACAACGTTTAACCCTACTTGGTCGCCAGGGGGCGCCAGATGAACGCTGTGAGTGCGTCTGTACATTTGTTGCAAGGGCTGGTTAGCGAGCCTGGCCCTGTCACTGATAAAACTTTTTGCACTAACCCCTCCACAAGTACCACCACCAAAAAAAAAAACTTTTTAAAGTTCCTGGTGGCGACTTTTTTGCTAAAAGTTGGCAATAAGAAAAAAACAGTGCGTNTTCAATTTTAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAACAAAAAAAAAAAATAATTAA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATGTTGTCTTTCTGTGTTTCCATACACCCCAGTTTTTATGCATCCAGTGATGTGAGGTTTCTCTTGTCTCACTGTGCTTTTTCATTAGGCTGGCAAAAGTAAAGGAATTCTTAATGGACTGCTTGATGCTTTCTGATCTTTTCATCACCTTGTTTCTGTGATGTTGTTTTTGAATGCACTGCTGTCCAAGCCTGAGGCCAAGGCACTTTGTGGCCTGCTGAACTTGTCTTCTGTCTTTGGCAACAGATGGCTGAACGCTGGGCTCTGCTGTTGCTTGGCAGAAGTCCATACATTTCTTGTCTTTACGCTTGGCACACACACACCTGCCTGCAGGCTCAAGGAGTTTCTCTTGGTCAGTGTCCTGCAATGCCCGTTTCATGCGGGGCCCTCCAAGACCATACGGTACTGTTCTCTCAGGAGTGTTGATCCATATGATGTCCAAGTGGCAGAAGTAGACACACTCTTTATCCATTAAAGAAGAACAAGAACAACGTTTAACCCTACTTGGTCGCCAGGGGGCGCCAGATGAACGCTGTGAGTGCGTCTGTACATTTGTTGCAAGGGCTGGTTAGCGAGCCTGGCCCTGTCACTGATAAAACTTTTTGCACTAACCCCTCCACAAGTACCACCACCAAAAAAAAAAACTTTTTAAAGTTCCTGGTGGCGACTTTTTTGCTAAAAGTTGGCAATAAGAAAAAAACAGTGCGTNTTCAATTTTAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAACAAAAAAAAAAAATAATTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATGTTGTCTTTCTGTGTTTCC