ORFeome > ednra ORF2 – XORFeome v1.0

ednra ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ednra
Gene ID: 6255871
Gene Page ID: 1006993
ORF Xenbase ID: 17273607

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129642
Original XGC clone length: 1248

Human orthology & disease relationships

NCBI Entrez ID: 1909
Ensembl gene IDs: ENSG00000151617
Directly associated (OMIM) disease MIM numbers: 157300
Indirectly associated (Lage, et al.) disease MIM numbers: 142623,176410,209880,277580,600155,600501

Library Location

Plate ID: GDExl11086
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ837873
dbEST ID: 79655575
Trimmed Sequence: ATGGGAGGAAACATCTTGAGATTCACCGTGCTGCTGGTGTTGGCCGGAATTGCGGTCAGCAGCAGTTTTGGGGAGTACTACCAAAATCGGACTGATGCCAGTACAGATTTCACGATGCTAAATCGGAGTCACACTTCACCGGTGAGAAAAGGAAATAGATCGGCTGATTTGTGCCCAGAAAAAACGAAGATTAACCACGTCTTTAAATATATAAACACAATCCTATCATGCACTATTTTCATTATCGGAATGGTTGGCAATGCAACGCTGCTTAGGATCATTTACCAGAACAAATGTATGAGGAATGGCCCAAATGCCCTGATAGCAAGCCTGGCCCTAGGAGACCTCATTTACATTGTTATTGACATCCCTATCATCGTGTTTAAGCTACTTGCCCAGCGTTGGCCCTTTGATCAGTCTCCTGTTGGAGCGTTCCTCTGCAAGCTGGTTCCCTTTATTCAAAAGGCTTCGGTTGGAATCACGGTGCTCAATCTGTGTGCCCTGAGTGTTGACAGGTACAGAGCAGTGGCATCCTGGAGCCGAGTTCAAGGTAGTGGAATTCCTCTTATCACAGCCATTGAAATTATCTCTATTTGGGTTCTGTCCTTCGTCCTGGCAATTCCTGAAGCTATTGGCCTTTGTCATGGTGGCCCTTTGAATATCGCCGGAAAACATTTTCAAAACATGGCTGGATCCACGCCAACAACCCCATTTTAT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAAACATCTTGAGATTCACCGTGCTGCTGGTGTTGGCCGGAATTGCGGTCAGCAGCAGTTTTGGGGAGTACTACCAAAATCGGACTGATGCCAGTACAGATTTCACGATGCTAAATCGGAGTCACACTTCACCGGTGAGAAAAGGAAATAGATCGGCTGATTTGTGCCCAGAAAAAACGAAGATTAACCACGTCTTTAAATATATAAACACAATCCTATCATGCACTATTTTCATTATCGGAATGGTTGGCAATGCAACGCTGCTTAGGATCATTTACCAGAACAAATGTATGAGGAATGGCCCAAATGCCCTGATAGCAAGCCTGGCCCTAGGAGACCTCATTTACATTGTTATTGACATCCCTATCATCGTGTTTAAGCTACTTGCCCAGCGTTGGCCCTTTGATCAGTCTCCTGTTGGAGCGTTCCTCTGCAAGCTGGTTCCCTTTATTCAAAAGGCTTCGGTTGGAATCACGGTGCTCAATCTGTGTGCCCTGAGTGTTGACAGGTACAGAGCAGTGGCATCCTGGAGCCGAGTTCAAGGTAGTGGAATTCCTCTTATCACAGCCATTGAAATTATCTCTATTTGGGTTCTGTCCTTCGTCCTGGCAATTCCTGAAGCTATTGGCCTTTGTCATGGTGGCCCTTTGAATATCGCCGGAAAACATTTTCAAAACATGGCTGGATCCACGCCAACAACCCCATTTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAAACATCTTGAGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ837872
dbEST ID: 79655574
Trimmed Sequence: ATTGATGCTGTCCTTGTGAATACTCCTGTCGGCTCCATAATAATTTTGCTCATGGTTTTTCCACTGGATACTTGTTACATTCATGGGAGCCGTATTAATATGTGTCTTAGACTGGCAACAACAGCAAAGGCATGACTGGAAACAGTTTTTAAATTTCTTGCTCACAAAATAGAGAGCTATGGGATTGATGCAGGAGTTGAGCGCTGCTAGATTAATACTGATGAAATCCATCACCAACAAAAAGCTTAGGAGTTCACAACGACTAGGATCCAACTCGTTGTAAATTGTATTCTTAATAATTCGGCTGAGATGTAATGGGAACCAGCAAAGAGCAAATATTACTACCAGGCAGAAAACAGTCTTTGCAACTTCACGACGCTGTTTGAGGTGCTCGCTAAGAGCAATTCTTAGGCTTCCTTTCCGCTGGTGTAGCATTTCACAGGTCATCATGGTATAAAACACTCCGGTACAAGCCAAAGGCACACAAAAGTATAAACCAAACAGCCACCAGTCTTTTGCATTTTTGTAGAACATCATAAATGGGCTTGTTGCGTGGAACATGCATGTTCTGAATTGTTCTCCGCGATACTCAAAGGGCACCATGACAAAGCCAATAGCTTCAGGAATTGCCAGGACGAAGGACAGAACCCAAATAGAAATAATTTCCATGGCTGTGATAAAAGAAATTCCACTACCTTGAACTCGGCTCCCGGATGCCACTGCTCTGTACTTGTTCACACTCAGGGCACACAGATTGAACCACGGGATTCCAACCCAACCCTTTTTAAATAAAGGGAACCAACTTTCCAAAAGAACGCTCCCAAAAGAAAACTGATCAAAGGGGCAAACGCCTGCCCAATTAGCTTAAACCACAATAAAAGGGGAGGTCCGAAAAAAATGTAAAATAAAGGTCTCCCAAGGCCCCAGGGCTTGCGTTTTAGGGGGAATTTTTGGGCGATTCCCCCAAAACTTTTTTTTCCTGGGTAAATTAAATCTAAAACCCAGCCGTTGCGCTTGTCCCACCCCTTTCCCAAAAAATTGAAAAAAAAATTGCAAATAAAAAAAAGAATGTTTTGTTTTTATA
Full Trace Sequence: GGGGCCAGGAACAGCTATGGACCATGTAATACGACTCACTATNAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGATGCTGTCCTTGTGAATACTCCTGTCGGCTCCATAATAATTTTGCTCATGGTTTTTCCACTGGATACTTGTTACATTCATGGGAGCCGTATTAATATGTGTCTTAGACTGGCAACAACAGCAAAGGCATGACTGGAAACAGTTTTTAAATTTCTTGCTCACAAAATAGAGAGCTATGGGATTGATGCAGGAGTTGAGCGCTGCTAGATTAATACTGATGAAATCCATCACCAACAAAAAGCTTAGGAGTTCACAACGACTAGGATCCAACTCGTTGTAAATTGTATTCTTAATAATTCGGCTGAGATGTAATGGGAACCAGCAAAGAGCAAATATTACTACCAGGCAGAAAACAGTCTTTGCAACTTCACGACGCTGTTTGAGGTGCTCGCTAAGAGCAATTCTTAGGCTTCCTTTCCGCTGGTGTAGCATTTCACAGGTCATCATGGTATAAAACACTCCGGTACAAGCCAAAGGCACACAAAAGTATAAACCAAACAGCCACCAGTCTTTTGCATTTTTGTAGAACATCATAAATGGGCTTGTTGCGTGGAACATGCATGTTCTGAATTGTTCTCCGCGATACTCAAAGGGCACCATGACAAAGCCAATAGCTTCAGGAATTGCCAGGACGAAGGACAGAACCCAAATAGAAATAATTTCCATGGCTGTGATAAAAGAAATTCCACTACCTTGAACTCGGCTCCCGGATGCCACTGCTCTGTACTTGTTCACACTCAGGGCACACAGATTGAACCACGGGATTCCAACCCAACCCTTTTTAAATAAAGGGAACCAACTTTCCAAAAGAACGCTCCCAAAAGAAAACTGATCAAAGGGGCAAACGCCTGCCCAATTAGCTTAAACCACAATAAAAGGGGAGGTCCGAAAAAAATGTAAAATAAAGGTCTCCCAAGGCCCCAGGGCTTGCGTTTTAGGGGGAATTTTTGGGCGATTCCCCCAAAACTTTTTTTTCCTGGGTAAATTAAATCTAAAACCCAGCCGTTGCGCTTGTCCCACCCCTTTCCCAAAAAATTGAAAAAAAAATTGCAAATAAAAAAAAGAATGTTTTGTTTTTATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGATGCTGTCCTTGTGAATACT