ORFeome > eef1a1 ORF2 – XORFeome v1.0

eef1a1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eef1a1
Gene ID: 865341
Gene Page ID: 480093
ORF Xenbase ID: 17273637

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043843
Original XGC clone length: 1389

Human orthology & disease relationships

NCBI Entrez ID: 1915
Ensembl gene IDs: ENSG00000156508
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,114480,124900,151660,153640,153650,154500,155100,173900,180105,219500,242860,250940,253300,253400,253550,268000,300240,305000,400042,600334,600652,603622,603689,603896,604145,604929,605249,605280,605850,608089,608456,608688,608807,608808,609322,610015

Library Location

Plate ID: GDExl11015
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ824219
dbEST ID: 79641921
Trimmed Sequence: ATGGGAAAGGAAAAGACTCACATCAACATCGTTGTCATTGGACACGTCGATTCTGGAAAGTCCACAACAACTGGCCATCTGATCTACAAATGTGGTGGCATCGACAAGAGAACCATTGAAAAGTTCGAGAAGGAAGCTGCCGAGATGGGAAAAGGCTCCTTCAAGTATGCCTGGGTCTTGGACAAACTGAAGGCAGAGCGTGAACGTGGTATCACCATTGACATCTCCCTGTGGAAATTTGAGACCAGCAAATACTATGTCACTATCATTGATGCTCCAGGACACAGAGATTTCATCAAGAACATGATCACTGGTACTTCTCAGGCCGACTGTGCTGTCCTGATTGTTGCTGCTGGTGTTGGTGAATTTGAAGCTGGTATCTCAAAGAATGGACAAACCCGTGAGCATGCTCTCCTTGCCTACACTCTGGGTGTTAAGCAGCTGATCGTTGGTATTAACAAAATGGATTCCACTGAACCACCATACAGCCAGAAGAGATATGAGGAAATTGTAAAGGAAGTCAGCACATACATCAAGAAAATTGGTTACAACCCTGACACTGTTGCCTTTGTGCCTATTTCTGGATGGAACGGTGACAACATGCTTGAGCCCAGCCCCAATATGCCTTGGTTTAAGGGATGGAAAATCACACGTAAAGAGGGATCTGGCAGCGGAACTACCCTGCTGGAAGCTCTTGACTGCATTTTGCCACCATCTCGCCCAACCCGATAAGCCTCTCCGTCTGCCCTCTGCAAGATGTCTACAAAAATGGGCCGGTATTG
Full Trace Sequence: CAGTATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGGAAAAGACTCACATCAACATCGTTGTCATTGGACACGTCGATTCTGGAAAGTCCACAACAACTGGCCATCTGATCTACAAATGTGGTGGCATCGACAAGAGAACCATTGAAAAGTTCGAGAAGGAAGCTGCCGAGATGGGAAAAGGCTCCTTCAAGTATGCCTGGGTCTTGGACAAACTGAAGGCAGAGCGTGAACGTGGTATCACCATTGACATCTCCCTGTGGAAATTTGAGACCAGCAAATACTATGTCACTATCATTGATGCTCCAGGACACAGAGATTTCATCAAGAACATGATCACTGGTACTTCTCAGGCCGACTGTGCTGTCCTGATTGTTGCTGCTGGTGTTGGTGAATTTGAAGCTGGTATCTCAAAGAATGGACAAACCCGTGAGCATGCTCTCCTTGCCTACACTCTGGGTGTTAAGCAGCTGATCGTTGGTATTAACAAAATGGATTCCACTGAACCACCATACAGCCAGAAGAGATATGAGGAAATTGTAAAGGAAGTCAGCACATACATCAAGAAAATTGGTTACAACCCTGACACTGTTGCCTTTGTGCCTATTTCTGGATGGAACGGTGACAACATGCTTGAGCCCAGCCCCAATATGCCTTGGTTTAAGGGATGGAAAATCACACGTAAAGAGGGATCTGGCAGCGGAACTACCCTGCTGGAAGCTCTTGACTGCATTTTGCCACCATCTCGCCCAACCCGATAAGCCTCTCCGTCTGCCCTCTGCAAGATGTCTACAAAAATGGGCCGGTATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGGAAAAGACTCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829528
dbEST ID: 79647230
Trimmed Sequence: TTTCGTTTTCGCGGCTTTCTGAGCAGACTTTGTGACTTTGCCGGATCCTGCTGCCTTCTTCTCGACTGCCTTGATTACTCCTACAGCAACGGTCTGTCTCATGTCACGAACAGCAAAACGACCAAGAGGAGGGTAGTCAGAGAAGCTCTCCACGCACATTGGCTTTCCTGGGATCATGTCAACAATGGCAGCATCACCAGACTTCAGGAACTTGGGATTGTCTTCCAGTTTCTTACCAGAACGGCGATCAATCTTCTCCTTGAGCTCAGCAAACTTGCAAGCAATGTGAGCAGTGTGACAATCCAACACAGGGGCATATCCAGCACCAATCTGGCCTGGGTGGTTCAGGATGATAACCTGTGCGGTAAATGAACCAGCTTCCATTGGTGGGTCATTCTTGCTGTCACCAGCAACGTTGCCACGACGGACGTCCTTCACAGATACGTTCTTGACGTTAAAACCAACGTTGTCACCGGGCACGGCCTCAGTAAGGGCTTCATGGTGCATTTCAACAGATTTCACTTCAGTTGTTACATTGACAGGGGCAAAGGTAACCACCATGCCTGGTTTAATGACACCAGTCTCCACACGACCAACTGGTACAGTACCAATACCGCCNATTTTGTAGACATCCTGCAGAGG
Full Trace Sequence: GAGGCGGCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCGTTTTCGCGGCTTTCTGAGCAGACTTTGTGACTTTGCCGGATCCTGCTGCCTTCTTCTCGACTGCCTTGATTACTCCTACAGCAACGGTCTGTCTCATGTCACGAACAGCAAAACGACCAAGAGGAGGGTAGTCAGAGAAGCTCTCCACGCACATTGGCTTTCCTGGGATCATGTCAACAATGGCAGCATCACCAGACTTCAGGAACTTGGGATTGTCTTCCAGTTTCTTACCAGAACGGCGATCAATCTTCTCCTTGAGCTCAGCAAACTTGCAAGCAATGTGAGCAGTGTGACAATCCAACACAGGGGCATATCCAGCACCAATCTGGCCTGGGTGGTTCAGGATGATAACCTGTGCGGTAAATGAACCAGCTTCCATTGGTGGGTCATTCTTGCTGTCACCAGCAACGTTGCCACGACGGACGTCCTTCACAGATACGTTCTTGACGTTAAAACCAACGTTGTCACCGGGCACGGCCTCAGTAAGGGCTTCATGGTGCATTTCAACAGATTTCACTTCAGTTGTTACATTGACAGGGGCAAAGGTAACCACCATGCCTGGTTTAATGACACCAGTCTCCACACGACCAACTGGTACAGTACCAATACCGCCNATTTTGTAGACATCCTGCAGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCGTTTTCGCGGCTTTCT