ORFeome > eef1a2 ORF1 – XORFeome v1.0

eef1a2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: eef1a2
Gene ID: 975444
Gene Page ID: 975438
ORF Xenbase ID: 17273649

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054279
Original XGC clone length: 1392

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ839389
dbEST ID: 79657091
Trimmed Sequence: ATGGGGAAAGAGAAGACACACATCAACATCGTGGTTATTGGCCACGTGGACTCTGGCAAGTCCACCACCACTGGCCACCTGATCTACAAGTGTGGAGGCATCGACAAAAGGACAATAGAGAAGTTTGAGAAGGAAGCAGCTGAGATGGGGAAAGGTTCCTTTAAATACGCTTGGGTTTTGGACAAACTGAAGGCTGAGAGGGAGCGAGGAATCACCATTGATATCTCCCTGTGGAAGTTTGAGACAACCAAATATTATATCACCATCATTGATGCTCCAGGACATCGAGACTTTATCAAGAATATGATCACTGGAACCTCTCAGGCAGACTGTGCAGTGCTGATAGTGGCAGCCGGGGTGGGTGAGTTTGAAGCTGGCATCTCCAAGAATGGACAGACTCGTGAACATGCCCTCCTGGCTTACACGCTTGGAGTAAAACAACTCATTGTGGGGATCAATAAGATGGACTCCACCGAGCCTCCTTACAGTGAGAAGCGTTATGATGAAATTGTGAAGGAGGTCAGCGCCTACATCAAGAAAATTGGCTACAACCCAGCTACGGTCCCCTTTGTACCCATTTCTGGCTGGCATGGGGATAACATGTTGGAACCCCTCTCCCATATGCCCTGGTTCAAGGGATGGAAAGTGAAGAAGGAAGGAAGCCAAAGCAAAGGAATTTTCCTGCTTAAGGCTTTGAACACCATCCCTCCCTCCTTCCGCCCAAACAAACAAACCTCCCCCTTCTTTTCCTCTCAAAAAATTTCCAAAAAAATTTTGAAAGAAAACCGCCCCCTGTTTTCCCATAATAGGCCCAAGATGGGAGA
Full Trace Sequence: CGAGGGCCAAATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGAGAAGACACACATCAACATCGTGGTTATTGGCCACGTGGACTCTGGCAAGTCCACCACCACTGGCCACCTGATCTACAAGTGTGGAGGCATCGACAAAAGGACAATAGAGAAGTTTGAGAAGGAAGCAGCTGAGATGGGGAAAGGTTCCTTTAAATACGCTTGGGTTTTGGACAAACTGAAGGCTGAGAGGGAGCGAGGAATCACCATTGATATCTCCCTGTGGAAGTTTGAGACAACCAAATATTATATCACCATCATTGATGCTCCAGGACATCGAGACTTTATCAAGAATATGATCACTGGAACCTCTCAGGCAGACTGTGCAGTGCTGATAGTGGCAGCCGGGGTGGGTGAGTTTGAAGCTGGCATCTCCAAGAATGGACAGACTCGTGAACATGCCCTCCTGGCTTACACGCTTGGAGTAAAACAACTCATTGTGGGGATCAATAAGATGGACTCCACCGAGCCTCCTTACAGTGAGAAGCGTTATGATGAAATTGTGAAGGAGGTCAGCGCCTACATCAAGAAAATTGGCTACAACCCAGCTACGGTCCCCTTTGTACCCATTTCTGGCTGGCATGGGGATAACATGTTGGAACCCCTCTCCCATATGCCCTGGTTCAAGGGATGGAAAGTGAAGAAGGAAGGAAGCCAAAGCAAAGGAATTTTCCTGCTTAAGGCTTTGAACACCATCCCTCCCTCCTTCCGCCCAAACAAACAAACCTCCCCCTTCTTTTCCTCTCAAAAAATTTCCAAAAAAATTTTGAAAGAAAACCGCCCCCTGTTTTCCCATAATAGGCCCAAGATGGGAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGAGAAGACAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839388
dbEST ID: 79657090
Trimmed Sequence: TTTTGCAGCCTTCTGGGCTTTCTGTGCGGACTTTGTCACCTTGCCAGCTCCTCCGATTTTCTTCTCCACGTTCTTAATGACTCCCACGGCCACAGTCTGCCTCATGTCTCTCACAGCAAAGCGCCCAAGAGGTGGGTATTGGGAGAAGCTCTCCACACACATAGGCTTCCCAGGGACCATCTCCACAATGGCAGCATCTCCAGATTTCAGAGACTTGGGGTTGTCCTCAAGCTTTTTGCCAGATCGGCGATCAATCTTTTCTTTTAGCTCTGCAAACTTACAGGCGATATGTGCAGTATGGCAGTCAATAACTGGGGAATATCCAGCACTGATCTGACCAGGGTGGTTCAAGATGATCACCTGAGCAGTGAAACCTGCGGCTTCCTGGGGAGGGTCAGTCTTGCTGTCACCACAAACATTGCCTCTGCGAATGTCCTTGACTGACACGTTCTTGACGTTGAAGCCAACATTGTCCCCAGGCAGAGCCTCACTCAGAGCCTCATGATGCATCTCAACAGACTTTACCTCAGTTGTGATATTGACTGGAGCAAAGGTCACCACCATGCCTGGCTTTAGAAAGCCGGTCTCCACTCGACCTACTGGAACAGTGCCGATTCCTCCATTTTATAGACATCTTGCAGAGAAAAAGGGAAAGGTTTGTCTGTTGGGCGAGATGGAAGGGGAAGAAATGGGTTCCAAAGCCCTCAAGCAGGGGAAAACTCCCATTTGCATTTGCCCTTCCCTTCCCCCTTCCCCTTTTCCCATTCCCCTT
Full Trace Sequence: CGGGAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTGCAGCCTTCTGGGCTTTCTGTGCGGACTTTGTCACCTTGCCAGCTCCTCCGATTTTCTTCTCCACGTTCTTAATGACTCCCACGGCCACAGTCTGCCTCATGTCTCTCACAGCAAAGCGCCCAAGAGGTGGGTATTGGGAGAAGCTCTCCACACACATAGGCTTCCCAGGGACCATCTCCACAATGGCAGCATCTCCAGATTTCAGAGACTTGGGGTTGTCCTCAAGCTTTTTGCCAGATCGGCGATCAATCTTTTCTTTTAGCTCTGCAAACTTACAGGCGATATGTGCAGTATGGCAGTCAATAACTGGGGAATATCCAGCACTGATCTGACCAGGGTGGTTCAAGATGATCACCTGAGCAGTGAAACCTGCGGCTTCCTGGGGAGGGTCAGTCTTGCTGTCACCACAAACATTGCCTCTGCGAATGTCCTTGACTGACACGTTCTTGACGTTGAAGCCAACATTGTCCCCAGGCAGAGCCTCACTCAGAGCCTCATGATGCATCTCAACAGACTTTACCTCAGTTGTGATATTGACTGGAGCAAAGGTCACCACCATGCCTGGCTTTAGAAAGCCGGTCTCCACTCGACCTACTGGAACAGTGCCGATTCCTCCATTTTATAGACATCTTGCAGAGAAAAAGGGAAAGGTTTGTCTGTTGGGCGAGATGGAAGGGGAAGAAATGGGTTCCAAAGCCCTCAAGCAGGGGAAAACTCCCATTTGCATTTGCCCTTCCCTTCCCCCTTCCCCTTTTCCCATTCCCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGCAGCCTTCTGGGCTT