ORFeome > eef1g ORF1 – XORFeome v1.0

eef1g ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: eef1g
Gene ID: 975020
Gene Page ID: 975012
ORF Xenbase ID: 17273673

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054190
Original XGC clone length: 1311

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ839084
dbEST ID: 79656786
Trimmed Sequence: ATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAAAAAGTTTGCCAAGATGCAGCCCAAAAAAAGAGACTCCCAAAAAAAAAGAAGCCAGCAAAAGAACCCCAAAAAAGAAAAAAGGAGGAAAAAAAAAAAAAGCAACCACCT
Full Trace Sequence: CTCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAAAAAGTTTGCCAAGATGCAGCCCAAAAAAAGAGACTCCCAAAAAAAAAGAAGCCAGCAAAAGAACCCCAAAAAAGAAAAAAGGAGGAAAAAAAAAAAAAGCAACCACCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGCGGGACTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839083
dbEST ID: 79656785
Trimmed Sequence: TTTGAAGATCTTGCCCTGGTTAAAGGGCTTGCCCACATTCTTGAATTCTCCTTCCCAGGCAAAGTATTCTTTGACCAGGGTTTTGCACTCCTCACTACCACTATCCAGCTTTCTCCAGTTGTAGGATTCGTAATCAATTTGCCAGTCTTCAGAGAGTGTAAAAGCAAGGTCTTGGCCTCTGAACACCCACACACCAGAGATGGAGCTGTTATTGTTGGTCCCGAACAAGATGACACTGGCAAAGCCAGTTTTACGCAGTTTGTCTAGACGCTGGAACATACCTGTAATTAAGCTGCAGCTCATAAAGGCTTGTGTCAGCTCCTCTGGAAATTTATACTCTGCGTACCAGATGGACCAGCCTTCCTTGTCAAAGTGCTCCCAGAAATAAGGCAGAGCAACAGTCAGGGTATCTTCATTTGAATATTTCCTCTTAAACTCATCCATTATAAAGGAGCTTTTAGGTAGATGTGCATATGGGTCCTTTGATTTAGGCTCTGCTGCTAAAGCCTTTTCAGATTCATCCAGGTCATCCTCAGGGGCTGGGGCAGGAGTAGGTGCTGCTTTCTTCTTTTCTCCTTTTCTTTTTGGGCTCCTTTGCTGGCTTCTCTTTCTTGGGAGTCTCTTTTTTGGGCTGCATTCTCGCAAAATTTCTGGGAATCAAACTGTTGCCTTCTTTGTCCAAAAGTTTTACCTTCCCCCCAACACAGCCCGGAAAATTCCGGGCGGAAATTCC
Full Trace Sequence: GCACGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGAAGATCTTGCCCTGGTTAAAGGGCTTGCCCACATTCTTGAATTCTCCTTCCCAGGCAAAGTATTCTTTGACCAGGGTTTTGCACTCCTCACTACCACTATCCAGCTTTCTCCAGTTGTAGGATTCGTAATCAATTTGCCAGTCTTCAGAGAGTGTAAAAGCAAGGTCTTGGCCTCTGAACACCCACACACCAGAGATGGAGCTGTTATTGTTGGTCCCGAACAAGATGACACTGGCAAAGCCAGTTTTACGCAGTTTGTCTAGACGCTGGAACATACCTGTAATTAAGCTGCAGCTCATAAAGGCTTGTGTCAGCTCCTCTGGAAATTTATACTCTGCGTACCAGATGGACCAGCCTTCCTTGTCAAAGTGCTCCCAGAAATAAGGCAGAGCAACAGTCAGGGTATCTTCATTTGAATATTTCCTCTTAAACTCATCCATTATAAAGGAGCTTTTAGGTAGATGTGCATATGGGTCCTTTGATTTAGGCTCTGCTGCTAAAGCCTTTTCAGATTCATCCAGGTCATCCTCAGGGGCTGGGGCAGGAGTAGGTGCTGCTTTCTTCTTTTCTCCTTTTCTTTTTGGGCTCCTTTGCTGGCTTCTCTTTCTTGGGAGTCTCTTTTTTGGGCTGCATTCTCGCAAAATTTCTGGGAATCAAACTGTTGCCTTCTTTGTCCAAAAGTTTTACCTTCCCCCCAACACAGCCCGGAAAATTCCGGGCGGAAATTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAAGATCTTGCCCTGGT