ORFeome > efna3 ORF1 – XORFeome v1.0

efna3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: efna3
Gene ID: 5720853
Gene Page ID: 5720825
ORF Xenbase ID: 17273745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054997
Original XGC clone length: 654

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ839471
dbEST ID: 79657173
Trimmed Sequence: ATGGCTGTGGTGTTTGTGCTTCTTTTCCCGCTGCTCTTCCTGTTTCCTCGCTCCGGAGCCAACAGGCACTCGGTCTACTGGAACAGCTCCAACTACCACCTGCGGCGGGACGGCTACACGGTGCAGGTGGATGTGAACGATTACCTGGATATCTATTGCCCCCACTACAATGAGTCGGTGGTGGAGCACAAGATGGAGCAGTACATCCTCTATATGGTGAGCTACGAGGGCTACCGGACCTGCAACATCAGCCAGGGCTTCAAGCGCTGGGAGTGTAACCGCCCCCACGTCCCCCACAGTCCAATCAAATTCTCCGAGAAGTTCCAGCGGTACAGCGCCTTCTCCTTGGGCTACGAGTTCCACGCCGGCCACGAGTACTACTATATCTCGACACCGACGCACAATCACAGGCGCTCCTGTCTGAAGATGAAAGTGTTTGTGTGCTGCGCCAGCACCTCCCACTCCGGAGAGAAACATTCCCCGACCCTGCCCCAGTTCACGATAGGCCCAGAGGTCAACATAGAGGATTTAGATAACTTCAACCCGGAGATCCCAAAGTTGGAGAAGAGCGTCAGCGGGAGCAGTCCCAAAAGGAAGCACTTACACTTAACAGTTGCAGTTTGTCTCCTTATAATGACGCTCCCTGGCTTCCTT
Full Trace Sequence: TCGGGGCACAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGTGGTGTTTGTGCTTCTTTTCCCGCTGCTCTTCCTGTTTCCTCGCTCCGGAGCCAACAGGCACTCGGTCTACTGGAACAGCTCCAACTACCACCTGCGGCGGGACGGCTACACGGTGCAGGTGGATGTGAACGATTACCTGGATATCTATTGCCCCCACTACAATGAGTCGGTGGTGGAGCACAAGATGGAGCAGTACATCCTCTATATGGTGAGCTACGAGGGCTACCGGACCTGCAACATCAGCCAGGGCTTCAAGCGCTGGGAGTGTAACCGCCCCCACGTCCCCCACAGTCCAATCAAATTCTCCGAGAAGTTCCAGCGGTACAGCGCCTTCTCCTTGGGCTACGAGTTCCACGCCGGCCACGAGTACTACTATATCTCGACACCGACGCACAATCACAGGCGCTCCTGTCTGAAGATGAAAGTGTTTGTGTGCTGCGCCAGCACCTCCCACTCCGGAGAGAAACATTCCCCGACCCTGCCCCAGTTCACGATAGGCCCAGAGGTCAACATAGAGGATTTAGATAACTTCAACCCGGAGATCCCAAAGTTGGAGAAGAGCGTCAGCGGGAGCAGTCCCAAAAGGAAGCACTTACACTTAACAGTTGCAGTTTGTCTCCTTATAATGACGCTCCCTGGCTTCCTTGCCCACTTTTCTTGTACAAAGTTGGAAATATAAGAAACCATTGCTTATTCATTTGTTTGAAACAAAAAAGGTCAATATTAGCTCAAAATTAAGATCCTTAATTTTCACAAAAAAAAAATAAAAAAACAAAAAAATAAAAAAAAAAAAAAAAAAAAATTGGGTCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGTGGTGTTTGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839470
dbEST ID: 79657172
Trimmed Sequence: GGAAGCCAGGAGCGTCATTATAAGGAGACAAACTGCAACTGTTAAGTGTAAGTGCTTCCTTTTGGGACTGCTCCCGCTGACGCTCTTCTCCAACTTTGGGATCTCCGGGTTGAAGTTATCTAAATCCTCTATGTTGACCTCTGGGCCTATCGTGAACTGGGGCAGGGTCGGGGAATGTTTCTCTCCAGAGTGGGAGGTGCTGGCGCAGCACACAAACACTTTCATCTTCACACAAGAGCGCCTGTGATTGTGCGTCGGTGTCGAGATATAATAATACTCGTGGCCGGCGTGGAACTCATACCCCAAAGAAAAGGCGCTGTACCGCTGGAACTTCTCAGAGAATTTGATTGGACTGTGGGGGACGTGGGCGCGGTTACACTCCCAGCGCTTGAAGCCCTGTCTGATGTTGCATGTCCTGTAGCCCTCGTATCTCACCATATAGAGGATGTACTGCTCCATCTTGTGCTCCACCACCCACACATTGTAGTGGGGGCAATAGATATCACGGTAATCGTTCACATCCACCTGCAACGTGTAACCGTCCCCCCCCAAGTTAGAATTGGAAGCGTTCCCTTAGAACAAGTGGGTGTGGGCTCCCGAAACAAGAAACGTGGGGAACAAGGGGGAAAAAAAAGAAAAAACCCAACACCCGGTGGGGCCAACTTTTTTTCTGAGAAAGAAGAGGATAAGAA
Full Trace Sequence: AGAGGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAGCCAGGAGCGTCATTATAAGGAGACAAACTGCAACTGTTAAGTGTAAGTGCTTCCTTTTGGGACTGCTCCCGCTGACGCTCTTCTCCAACTTTGGGATCTCCGGGTTGAAGTTATCTAAATCCTCTATGTTGACCTCTGGGCCTATCGTGAACTGGGGCAGGGTCGGGGAATGTTTCTCTCCAGAGTGGGAGGTGCTGGCGCAGCACACAAACACTTTCATCTTCACACAAGAGCGCCTGTGATTGTGCGTCGGTGTCGAGATATAATAATACTCGTGGCCGGCGTGGAACTCATACCCCAAAGAAAAGGCGCTGTACCGCTGGAACTTCTCAGAGAATTTGATTGGACTGTGGGGGACGTGGGCGCGGTTACACTCCCAGCGCTTGAAGCCCTGTCTGATGTTGCATGTCCTGTAGCCCTCGTATCTCACCATATAGAGGATGTACTGCTCCATCTTGTGCTCCACCACCCACACATTGTAGTGGGGGCAATAGATATCACGGTAATCGTTCACATCCACCTGCAACGTGTAACCGTCCCCCCCCAAGTTAGAATTGGAAGCGTTCCCTTAGAACAAGTGGGTGTGGGCTCCCGAAACAAGAAACGTGGGGAACAAGGGGGAAAAAAAAGAAAAAACCCAACACCCGGTGGGGCCAACTTTTTTTCTGAGAAAGAAGAGGATAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAGCCAGGAGCGTCA