ORFeome > efnb2 ORF1 – XORFeome v1.0

efnb2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: efnb2
Gene ID: 6255186
Gene Page ID: 488605
ORF Xenbase ID: 17273751

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057724
Original XGC clone length: 990

Human orthology & disease relationships

NCBI Entrez ID: 1948
Ensembl gene IDs: ENSG00000125266
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125853,130060,166200,166210,166220,259420,304110,607785,608232,608354,608355

Library Location

Plate ID: GDExl11019
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ824571
dbEST ID: 79642273
Trimmed Sequence: ATGGCACTGAGCGGGGACTCGGTGTGGAAGTACAGCCTGGGAGTTTGTATTCTCTTGCTCAGGACTGCGATCTCCTGGTCTACAGTGCTGGATCCTATATACTGGAACTCGTCCAACGCCAGGTTTCTTCCTGGACAAGGGCTGATCCTGTACCCAAAGATAGGCGATAAACTGGACATCATATGTCCTAAAGTGGACTCCAAATCGACAGGCCAATACGAGTATTATAAAATCTACTTGGTGGATAAAGAGCAAGCGGACAGCTGCACAATAAAAGACAGAACACCTTTGCTCAACTGTGCTAAGCCAGATCAAGATGTGAAATTTACTATCAAGTTTCAAGAGTTTAGCCCAAATCTCTGGGGACTGGAATTCCAAAGAGACAAAGACTATTACATCATATCTACATCAAATGGCTCTATAGAGGGTGTGGATAATCAAGAAGGAGGAGTATGTGTAACAAAAGCCATGAAAATCCTCATGAAAGTTGGACAAGATCCTGACTTTCATAACCATCGAGGCTCGTCTTCAACAAGACGCCCCGACCACGAGTCTGGTACCAATGGAAAGAGTTCAACCACTAGTCCACATGTCAATGGCCCTGAAGGCTCTAGCACAGATGGAAAAAATGCTGGACATTCAAGTATCTTGGGATCCGAGGTGGCCTATTTTGCGGGGATTGCTTCAGGGTGCATAATCTTCATTGTCATCATAATCACTCCTTTGTGGTGCTGTTGGTGAAATACAGAAGAAGAACACAAAAAGCAATCACCCCCAGCCACACAACAACCTTATTCACCTCAGTAACATTAGCCCCCTTCCCAAAAACCCAATGGCC
Full Trace Sequence: AATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACTGAGCGGGGACTCGGTGTGGAAGTACAGCCTGGGAGTTTGTATTCTCTTGCTCAGGACTGCGATCTCCTGGTCTACAGTGCTGGATCCTATATACTGGAACTCGTCCAACGCCAGGTTTCTTCCTGGACAAGGGCTGATCCTGTACCCAAAGATAGGCGATAAACTGGACATCATATGTCCTAAAGTGGACTCCAAATCGACAGGCCAATACGAGTATTATAAAATCTACTTGGTGGATAAAGAGCAAGCGGACAGCTGCACAATAAAAGACAGAACACCTTTGCTCAACTGTGCTAAGCCAGATCAAGATGTGAAATTTACTATCAAGTTTCAAGAGTTTAGCCCAAATCTCTGGGGACTGGAATTCCAAAGAGACAAAGACTATTACATCATATCTACATCAAATGGCTCTATAGAGGGTGTGGATAATCAAGAAGGAGGAGTATGTGTAACAAAAGCCATGAAAATCCTCATGAAAGTTGGACAAGATCCTGACTTTCATAACCATCGAGGCTCGTCTTCAACAAGACGCCCCGACCACGAGTCTGGTACCAATGGAAAGAGTTCAACCACTAGTCCACATGTCAATGGCCCTGAAGGCTCTAGCACAGATGGAAAAAATGCTGGACATTCAAGTATCTTGGGATCCGAGGTGGCCTATTTTGCGGGGATTGCTTCAGGGTGCATAATCTTCATTGTCATCATAATCACTCCTTTGTGGTGCTGTTGGTGAAATACAGAAGAAGAACACAAAAAGCAATCACCCCCAGCCACACAACAACCTTATTCACCTCAGTAACATTAGCCCCCTTCCCAAAAACCCAATGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTGAGCGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829922
dbEST ID: 79647624
Trimmed Sequence: GACTTTGTAGTAAATATTTGCTGGGCTCTGAGGTGGCATCTCCTGGACAATGTAAACAGGATGTCCATAATCTCCACTTACTTTCTCATAATGAGGGCAGAAAACACCCTCTGCAGTCCTTAAAGGAATAATAATGTCACTTGGCTCTGAACCATTGTTATTGCCACTGCGTTTTGGAGTGGCTAATGTACTGAGTGATAAAGTTGTTGTGTGCTGGGGTGAATGCTTTCTGTGTCTTCTTCTGTATTTCAACAACAGCACCACAAGAGTGATTATGATGACAATGAAGATTATGCACCCTGAAGCAATCCCCGCAAATAAGGCCACCTCGGATCCCAAGATACTTGAATGTCCAGCATTTTTTCCATCTGTGCTAGAGCCTTCAGGGCCATTGACATGTGGACTAGTGGTTGAACTCTTTCCATTGGTACCAGACTCGTGGTCGGGGCGTCTTGTTGAAGACGAGCCTCGATGGTTATGAAAGTCAGGATCTTGTCCAACTTTCATGAGGATTTTCATGGCTTTTGTTACACATACTCCTCCTTCTTGATTATCCACACCCTCTATAGAGCCATTTGATGTAAATATGATGTAATAGTCTTTGTCTCTTTGGAATTCCAGTCCCCAGAGATTTGGGGCTAAACTCTTGAAAACTTGATAGTAAAATTTCACATCTTGGATCTGGCCTTACCACAGTTTGAAGCAAAAGGTGTTTCTGGTC
Full Trace Sequence: GGCCGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTTTGTAGTAAATATTTGCTGGGCTCTGAGGTGGCATCTCCTGGACAATGTAAACAGGATGTCCATAATCTCCACTTACTTTCTCATAATGAGGGCAGAAAACACCCTCTGCAGTCCTTAAAGGAATAATAATGTCACTTGGCTCTGAACCATTGTTATTGCCACTGCGTTTTGGAGTGGCTAATGTACTGAGTGATAAAGTTGTTGTGTGCTGGGGTGAATGCTTTCTGTGTCTTCTTCTGTATTTCAACAACAGCACCACAAGAGTGATTATGATGACAATGAAGATTATGCACCCTGAAGCAATCCCCGCAAATAAGGCCACCTCGGATCCCAAGATACTTGAATGTCCAGCATTTTTTCCATCTGTGCTAGAGCCTTCAGGGCCATTGACATGTGGACTAGTGGTTGAACTCTTTCCATTGGTACCAGACTCGTGGTCGGGGCGTCTTGTTGAAGACGAGCCTCGATGGTTATGAAAGTCAGGATCTTGTCCAACTTTCATGAGGATTTTCATGGCTTTTGTTACACATACTCCTCCTTCTTGATTATCCACACCCTCTATAGAGCCATTTGATGTAAATATGATGTAATAGTCTTTGTCTCTTTGGAATTCCAGTCCCCAGAGATTTGGGGCTAAACTCTTGAAAACTTGATAGTAAAATTTCACATCTTGGATCTGGCCTTACCACAGTTTGAAGCAAAAGGTGTTTCTGGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTTGTAGTAAATATTTGCTGG