ORFeome > ehd2 ORF1 – XORFeome v1.0

ehd2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ehd2
Gene ID: 957218
Gene Page ID: 957212
ORF Xenbase ID: 17273811

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054951
Original XGC clone length: 1617

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ839102
dbEST ID: 79656804
Trimmed Sequence: ATGTTCAGCTGGATGGGCAAGAACGAGAAAACCAAAAAGTCCCCCGAGGTCATCCACACGGTGACCGAGGGCCTGAAGGACCTGTACAAGAAGAAGCTGAAGCCAGTGGAGGACTTCTACAGGTTCCATGACTTCCACTCCCCAGCACTGGAGGATGCTGATTTTGACAATAAGCCCATGGTGCTGGTGGTGGGACAGTACTCCACTGGGAAGACCACCTTCATCAAGTATCTGCTAGAGCAGGACATCCCTGGCAGTCGCATTGGCCCAGAGCCTACCACCGACTCCTTCATAGCTGTCATGCACGGAGAGACAGAAGGAGTGACACCTGGCAATGCCCTCATGGTGGATCCCAATAAACCTTTCCGCAAACTTAATCCCTTCGGAAACACATTTCTGAACAGGTTTATGTGTGCCCATTTGCCCAATAAGGTTTTGGAAAGCATTAGTCTTATAGACACTCCAGGTATCCTATCTGGTGCCAAGCAGCGGGTGAGCAGAGGCTATGACTTTCCTGCAGTACTTCAGTGGTTTGCTGAAAGGGTGGACCGTATCATTCTTCTCTTTGATGCCCACAAACTGGAGATCTCTGATGAGTTCTCTGAAGCCATTCGAGCTCTAAAGGGCAATGAGGACAAGATTCGTGTGGTCCTGAACAAAGCTGACATGGTGGAAACCCACAGCTCATGCGTGTCTATGGTGCCCTGATGTGGTCTCT
Full Trace Sequence: GGGGGATCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCAGCTGGATGGGCAAGAACGAGAAAACCAAAAAGTCCCCCGAGGTCATCCACACGGTGACCGAGGGCCTGAAGGACCTGTACAAGAAGAAGCTGAAGCCAGTGGAGGACTTCTACAGGTTCCATGACTTCCACTCCCCAGCACTGGAGGATGCTGATTTTGACAATAAGCCCATGGTGCTGGTGGTGGGACAGTACTCCACTGGGAAGACCACCTTCATCAAGTATCTGCTAGAGCAGGACATCCCTGGCAGTCGCATTGGCCCAGAGCCTACCACCGACTCCTTCATAGCTGTCATGCACGGAGAGACAGAAGGAGTGACACCTGGCAATGCCCTCATGGTGGATCCCAATAAACCTTTCCGCAAACTTAATCCCTTCGGAAACACATTTCTGAACAGGTTTATGTGTGCCCATTTGCCCAATAAGGTTTTGGAAAGCATTAGTCTTATAGACACTCCAGGTATCCTATCTGGTGCCAAGCAGCGGGTGAGCAGAGGCTATGACTTTCCTGCAGTACTTCAGTGGTTTGCTGAAAGGGTGGACCGTATCATTCTTCTCTTTGATGCCCACAAACTGGAGATCTCTGATGAGTTCTCTGAAGCCATTCGAGCTCTAAAGGGCAATGAGGACAAGATTCGTGTGGTCCTGAACAAAGCTGACATGGTGGAAACCCACAGCTCATGCGTGTCTATGGTGCCCTGATGTGGTCTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCAGCTGGATGGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839101
dbEST ID: 79656803
Trimmed Sequence: TTCAGCAGAGCCTTTCTGTCTTCTTTTTGATGGTGGGATCAGATGTCTTGGCAGCTCGGGTGGTAGCCCATGACCTTCCAATTTAACTTCAATCAAATGGCTTGCAAGGGCAAACTCTTCATCATCCAGCATTCCATCGCGATCAACATCAGAGAGTTTCCAGATCTTGCCTAGCACAGAATTGGGCAGCTTAGTGGTTACCATCCAGTTCTTGGCTTTGGTGCCAGTGATTTTTCCATCAGTGGGGGCTAAATTAAAGAATATCTCATCATATTTAGATTTGTCCTTGGTAACCACCCATTCTTCATCATCCAGACCCTCAAAGATCCCATCAGTGGAACCCTCTATGAAAGGACCATTATGGGTACCATCAAAGGCCCCTCCTTGGACCACATTATCACAGGTTTCCAAGTCTTCCTGGCGAAGCAGTGGCATTAGTTTTGCAATGTCAACTGTCAGCATCTCATCCAAAGCCTCAATCATATGAGGCTTTAAGGCATGAAATTTCTTGAAGTCATGAATCGCCAGTTGCTCCTGCATTTTGGCACAGTCAGGGAAATCTCCAGGTGAAATATGATGCTCCAGCTGTATCTTGGCAAATATAACAGGGAACTTGGTTAATAAGCTGGTTCCTTTTTGTTGTCCTTTGCCAAAGAATGGAGGGCATCTTCCTTTCTTCCAAGTGACCTTATAATGGTGAAGCATGGGAACCCTTTAAAAAGCCCGGGGGTCTTTTTTTAAAACCCAA
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGCAGAGCCTTTCTGTCTTCTTTTTGATGGTGGGATCAGATGTCTTGGCAGCTCGGGTGGTAGCCCATGACCTTCCAATTTAACTTCAATCAAATGGCTTGCAAGGGCAAACTCTTCATCATCCAGCATTCCATCGCGATCAACATCAGAGAGTTTCCAGATCTTGCCTAGCACAGAATTGGGCAGCTTAGTGGTTACCATCCAGTTCTTGGCTTTGGTGCCAGTGATTTTTCCATCAGTGGGGGCTAAATTAAAGAATATCTCATCATATTTAGATTTGTCCTTGGTAACCACCCATTCTTCATCATCCAGACCCTCAAAGATCCCATCAGTGGAACCCTCTATGAAAGGACCATTATGGGTACCATCAAAGGCCCCTCCTTGGACCACATTATCACAGGTTTCCAAGTCTTCCTGGCGAAGCAGTGGCATTAGTTTTGCAATGTCAACTGTCAGCATCTCATCCAAAGCCTCAATCATATGAGGCTTTAAGGCATGAAATTTCTTGAAGTCATGAATCGCCAGTTGCTCCTGCATTTTGGCACAGTCAGGGAAATCTCCAGGTGAAATATGATGCTCCAGCTGTATCTTGGCAAATATAACAGGGAACTTGGTTAATAAGCTGGTTCCTTTTTGTTGTCCTTTGCCAAAGAATGGAGGGCATCTTCCTTTCTTCCAAGTGACCTTATAATGGTGAAGCATGGGAACCCTTTAAAAAGCCCGGGGGTCTTTTTTTAAAACCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGCAGAGCCTTTCTGT