ORFeome > eif1b ORF1 – XORFeome v1.0

eif1b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: eif1b
Gene ID: 1010220
Gene Page ID: 1010214
ORF Xenbase ID: 17273841

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054139
Original XGC clone length: 342

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ839128
dbEST ID: 79656830
Trimmed Sequence: ATGTCCTCTATCCAGAACCTCAACTCTTTCGACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTATATCCATATAAGAATCCAGCAACGTAACGGCAGGAAAACATTAACAACTGTACAGGGAATCGCAGATGATTATGACAAAAAGAAGCTTGTAAAAGCTTTCAAGAAGAAATTTGCTTGTAATGGTACTGTGATTGAGCATCCTGAATACGGAGAAGTCATCCAGCTTCAGGGAGATCAACGAAAAAACATCTGCCAATTTCTTATGGAGATTGGCATTGTCAAGGAAGAACAATTAAAGGTCCATGGTTTCTT
Full Trace Sequence: GGGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTCTATCCAGAACCTCAACTCTTTCGACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTATATCCATATAAGAATCCAGCAACGTAACGGCAGGAAAACATTAACAACTGTACAGGGAATCGCAGATGATTATGACAAAAAGAAGCTTGTAAAAGCTTTCAAGAAGAAATTTGCTTGTAATGGTACTGTGATTGAGCATCCTGAATACGGAGAAGTCATCCAGCTTCAGGGAGATCAACGAAAAAACATCTGCCAATTTCTTATGGAGATTGGCATTGTCAAGGAAGAACAATTAAAGGTCCATGGTTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTATGGAACATGTCTCAAAATCTCTGATGTTACAGTNGGNNCTGCCGGGGCTGGTGGCTCCGGCTGGCTACAAATCAAAGTGCCTTTGATTTTCCTTTTGTATCGGAGTAAGGCCTCACCCTGGGAGGAAAATCCTGGCAGAGTTCGTATTCTTCCTGTAGAAGCACGGCCCTACCGGCACTGGTCAAAACCCTGAAAGAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTCTATCCAGAACCTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839127
dbEST ID: 79656829
Trimmed Sequence: GAAACCATGGACCTTTAATTGTTCTTCCTTGACAATGCCAATCTCCATAAGAAATTGGCAGATGTTTTTTCGTTGATCTCCCTGAAGCTGGATGACTTCTCCGTATTCAGGATGCTCAATCACAGTACCATTACAAGCAAATTTCTTCTTGAAAGCTTTTACAAGCTTCTTTTTGTCATAATCATCTGCGATTCCCTGTACAGTTGTTAATGTTTTCCTGCCGTTACGTTGCTGGATTCTTATATGGATATAATCCTCAGTCCCTGCCGGGAGTAAGTCGTCACCCTTAGTTGCATCAGCAAAGGGGTCGAAAGAGTTGAGGTTCTGGATAGAGGACATGG
Full Trace Sequence: GCGGGGATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNNCNNATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAACCATGGACCTTTAATTGTTCTTCCTTGACAATGCCAATCTCCATAAGAAATTGGCAGATGTTTTTTCGTTGATCTCCCTGAAGCTGGATGACTTCTCCGTATTCAGGATGCTCAATCACAGTACCATTACAAGCAAATTTCTTCTTGAAAGCTTTTACAAGCTTCTTTTTGTCATAATCATCTGCGATTCCCTGTACAGTTGTTAATGTTTTCCTGCCGTTACGTTGCTGGATTCTTATATGGATATAATCCTCAGTCCCTGCCGGGAGTAAGTCGTCACCCTTAGTTGCATCAGCAAAGGGGTCGAAAGAGTTGAGGTTCTGGATAGAGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAATAATGGACAGTAATTTACAACAACGTGACATAGCTGTTNCCTGGCAGCTCTGGCCCGGGTCGCAAAAACACTGATATTACAANAAAAAAAANNNNNNNGNNGNNNANGNNNNNNNNNNNNGGNAGANNTNNGGGNNNNNANNANNNGGNANGAAGNNNNNNNNGNNNNNNNNNNGNNNNNNGNNGNNNNNNNNNNNNNNNNGNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNTTGGNNNNNNNNNNNNNNGNNGNNNNNNGNNNNNNNNANNNNNNNA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAACCATGGACCTTTAATTGTTC