ORFeome > eif2b2 ORF1 – XORFeome v1.0

eif2b2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif2b2
Gene ID: 974095
Gene Page ID: 974088
ORF Xenbase ID: 17273853

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041556
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID: 8892
Ensembl gene IDs: ENSG00000119718
Directly associated (OMIM) disease MIM numbers: 603896
Indirectly associated (Lage, et al.) disease MIM numbers: 102700,219500,266120,278300,300322,300323,400042,600462,603896,605258

Library Location

Plate ID: GDExl11014
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ824148
dbEST ID: 79641850
Trimmed Sequence: ATGCCGGGGATAACCGAGAAGGAGTCGGAGTTGTCAGAGCGTATAGAGGCTTTTGTGGCTGAGTTGAAGCGAGGCGGAGGGCGACCAAGTTCCGATGAAACGGCTAGAGAAACAGTGGGGCTGCTGCGGCGCATAATAGCGCAGGCTCGGTGGGGAAATGCTGGAGAACTTATGGAGATTATCCGTAGAGAAGGGAGACGCATGACAGCAGCTCAACCATCCGAAACCACAGTGGGGAACATGGTACGTCGGGTGCTGAAACTGATTCGTGAGGAGTATGGCAGGCTGCACGGCTTCAGTGAGGAAAATGACCAGCAGGAGTCTCTACATAGGCTGGTTACAGTAGAAAAACTGAGCGATGATTTTAATACACCACTTCCTCTGCTGAAAGCCAATGTCATTGAGGCAGTTAATGAGCTGCTGATAGAACTGGAGGGAACCACTGATAATATTGCAATTCAGGCCAAAGAGCACATTCACTCAAATGAAGTCATCATGACCATTGGACGATCGCGCACAGTGCAGCTGTTTTTGGAGGAAGCCGCTCGCAAACGCAAATTCCATGTTATTGTNGGCAGAGTGTGCACCCTTTTGTCAGGGACATGAAATGGCGGCCAGCTTGTCAAAAGCTGGGATTGAACCACTGTGATTCCAGATGCTGCTATTTTTGCTGTCATGTCAGGGGTGAATAAGTTCCNNCATGAAGAGATCCCTTTTCACAGTTTGTATCCACCACAGAAGTGCTGCCATTTTTCCGAAGGTGAGATCCCCCTCCTAGGTTAATGGGTTTATTGGCCGCAATTTTTTGCCCCCCTTACCCCCCCCAAATGTGATCCCCTTTAT
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGGGGATAACCGAGAAGGAGTCGGAGTTGTCAGAGCGTATAGAGGCTTTTGTGGCTGAGTTGAAGCGAGGCGGAGGGCGACCAAGTTCCGATGAAACGGCTAGAGAAACAGTGGGGCTGCTGCGGCGCATAATAGCGCAGGCTCGGTGGGGAAATGCTGGAGAACTTATGGAGATTATCCGTAGAGAAGGGAGACGCATGACAGCAGCTCAACCATCCGAAACCACAGTGGGGAACATGGTACGTCGGGTGCTGAAACTGATTCGTGAGGAGTATGGCAGGCTGCACGGCTTCAGTGAGGAAAATGACCAGCAGGAGTCTCTACATAGGCTGGTTACAGTAGAAAAACTGAGCGATGATTTTAATACACCACTTCCTCTGCTGAAAGCCAATGTCATTGAGGCAGTTAATGAGCTGCTGATAGAACTGGAGGGAACCACTGATAATATTGCAATTCAGGCCAAAGAGCACATTCACTCAAATGAAGTCATCATGACCATTGGACGATCGCGCACAGTGCAGCTGTTTTTGGAGGAAGCCGCTCGCAAACGCAAATTCCATGTTATTGTNGGCAGAGTGTGCACCCTTTTGTCAGGGACATGAAATGGCGGCCAGCTTGTCAAAAGCTGGGATTGAACCACTGTGATTCCAGATGCTGCTATTTTTGCTGTCATGTCAGGGGTGAATAAGTTCCNNCATGAAGAGATCCCTTTTCACAGTTTGTATCCACCACAGAAGTGCTGCCATTTTTCCGAAGGTGAGATCCCCCTCCTAGGTTAATGGGTTTATTGGCCGCAATTTTTTGCCCCCCTTACCCCCCCCAAATGTGATCCCCTTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGGGATAACCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829455
dbEST ID: 79647157
Trimmed Sequence: CAGTTCATGGTCTGATGGGTGGTACAGCTCACTCATCAGTCGATAGATGTATGATGGTGCATTTCCTCCAATGTTTGAGATGAATAATGTGATCAGTTCTGGGGGTACGTGGTCAAAAATCGGGCAATAAGCACTAACCTGAGAGAGGATCTCACCTTCTGAAAATGGCAGCACTTCCTGTGGTGATACAAACTTGTGAAAGGAATCTTCTTCATTGGGGAACTTATTCACCCTTGACATGACAGCAAAAATAGCAGCATCTGGAATCACAGTGGTTTCAATCCCAGCTTTTGACAAGCTGGCCGCCATTTCATGTCCCTGACAAAAGGGTGCACACTCTGCCACAATAACATGGAATTTGCGTTTGCGAGCGGCTTCCTCCAAAAACAGCTGCACTGTGCGCGATCGTCCAATGGTCATGATGACTTCATTTGAGTGAATGTGCTCTTTGGCCTGAATTGCAATATTATCAGTGGTTCCCTCCAGTTCTATCAGCAGCTCATTAACTGCCTCAATGACATTGGCTTTCAGCAGAGGAAGTGGTGTATTAAAATCATCGCTCAGTTTTTCTACTGTAACCAGCCTATGTAGAGACTCCTGCTGGTCATTTTCCTCACTGAGGCCGTGCAGCCTGCCCTACTCCTCACGAATCAGTTTCAGCACCCGACGTACCAGTTTCCCCACTGGGGTTTTCGGAAGGGTTGAAACTGCTTGGTCAGGCCGTCTCCCTTTTCCTACGGGAAAAACCTTCCATAAATTTCCTCCCGGCA
Full Trace Sequence: TGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTTCATGGTCTGATGGGTGGTACAGCTCACTCATCAGTCGATAGATGTATGATGGTGCATTTCCTCCAATGTTTGAGATGAATAATGTGATCAGTTCTGGGGGTACGTGGTCAAAAATCGGGCAATAAGCACTAACCTGAGAGAGGATCTCACCTTCTGAAAATGGCAGCACTTCCTGTGGTGATACAAACTTGTGAAAGGAATCTTCTTCATTGGGGAACTTATTCACCCTTGACATGACAGCAAAAATAGCAGCATCTGGAATCACAGTGGTTTCAATCCCAGCTTTTGACAAGCTGGCCGCCATTTCATGTCCCTGACAAAAGGGTGCACACTCTGCCACAATAACATGGAATTTGCGTTTGCGAGCGGCTTCCTCCAAAAACAGCTGCACTGTGCGCGATCGTCCAATGGTCATGATGACTTCATTTGAGTGAATGTGCTCTTTGGCCTGAATTGCAATATTATCAGTGGTTCCCTCCAGTTCTATCAGCAGCTCATTAACTGCCTCAATGACATTGGCTTTCAGCAGAGGAAGTGGTGTATTAAAATCATCGCTCAGTTTTTCTACTGTAACCAGCCTATGTAGAGACTCCTGCTGGTCATTTTCCTCACTGAGGCCGTGCAGCCTGCCCTACTCCTCACGAATCAGTTTCAGCACCCGACGTACCAGTTTCCCCACTGGGGTTTTCGGAAGGGTTGAAACTGCTTGGTCAGGCCGTCTCCCTTTTCCTACGGGAAAAACCTTCCATAAATTTCCTCCCGGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCATGGTCTGATGGGT