ORFeome > eif2b4 ORF1 – XORFeome v1.0

eif2b4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif2b4
Gene ID: 997734
Gene Page ID: 997730
ORF Xenbase ID: 17273865

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122497
Original XGC clone length: 1710

Human orthology & disease relationships

NCBI Entrez ID: 8890
Ensembl gene IDs: ENSG00000115211
Directly associated (OMIM) disease MIM numbers: 603896
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11087
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ838168
dbEST ID: 79655870
Trimmed Sequence: ATGGACAGGAGAGGGGAGAGCGAGCAGAAGGCCGGTGGTGGTGGTAAAGTAAAGAAGTCTGAGTCTCGCCATGCCAAGGGGGAAGGGCAAGAGATGAGTAAGGAGGAGAAGCTTCGTCTGCGCAAAGAAAAGAAACAACAGAAGAAGAACAAGGAGAAGGCGTCATCTGAGCCAACCAAGGAGGCCCCAGTCATAGAGAGAGATGCTCCGCCTAGTGCCACAAATGCCACCTCTCCATGCTCTTTGCCCCAAGTACCTGCCCCAGTGGCAGAGGAGGTGACCACTGATAAGTCAGACCCAGTAGCCAAGGCTCCTGCTGGGGGAGGAAAGGGCAAGTCAGAGGCAGTAGGGGAGGCGCCCGCTGGAAGTGCAAAGAGCAAACCTGGGGCAGGAGCAGAGGGATCTACTGGGGGTGGAAAGATCAAATCTGAGCTTCGGGCAGAAAGAAGAATAAAGCAAGAGGCTGAGCGGGCACAGAAACTGCTGAAGAAAACAAAACAGAGTGCAGTGCCTGCGCACGGCAAAGCCAAGGCTGTTTCCATTGATGGACAGACAATGAAACGACTTCCATAACACATATCTGTGGATGATGCAGCAGCACAAAAGAAACTTACTAAAAAATTGAAACTGCAGCAGGTTCCTCTGCCCGCCAAGCATTACAAAAAAGTTAATCTTGTCTCCCCCCGTCCACAACTCCTTTCCCAAGTTTCGCCCTTCGCCCGCCAATAAAATAATCCTCCTTTTTTCTCCCCCCCCGGCGCCCGGGGG
Full Trace Sequence: TCGTGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAGGAGAGGGGAGAGCGAGCAGAAGGCCGGTGGTGGTGGTAAAGTAAAGAAGTCTGAGTCTCGCCATGCCAAGGGGGAAGGGCAAGAGATGAGTAAGGAGGAGAAGCTTCGTCTGCGCAAAGAAAAGAAACAACAGAAGAAGAACAAGGAGAAGGCGTCATCTGAGCCAACCAAGGAGGCCCCAGTCATAGAGAGAGATGCTCCGCCTAGTGCCACAAATGCCACCTCTCCATGCTCTTTGCCCCAAGTACCTGCCCCAGTGGCAGAGGAGGTGACCACTGATAAGTCAGACCCAGTAGCCAAGGCTCCTGCTGGGGGAGGAAAGGGCAAGTCAGAGGCAGTAGGGGAGGCGCCCGCTGGAAGTGCAAAGAGCAAACCTGGGGCAGGAGCAGAGGGATCTACTGGGGGTGGAAAGATCAAATCTGAGCTTCGGGCAGAAAGAAGAATAAAGCAAGAGGCTGAGCGGGCACAGAAACTGCTGAAGAAAACAAAACAGAGTGCAGTGCCTGCGCACGGCAAAGCCAAGGCTGTTTCCATTGATGGACAGACAATGAAACGACTTCCATAACACATATCTGTGGATGATGCAGCAGCACAAAAGAAACTTACTAAAAAATTGAAACTGCAGCAGGTTCCTCTGCCCGCCAAGCATTACAAAAAAGTTAATCTTGTCTCCCCCCGTCCACAACTCCTTTCCCAAGTTTCGCCCTTCGCCCGCCAATAAAATAATCCTCCTTTTTTCTCCCCCCCCGGCGCCCGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAGGAGAGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838167
dbEST ID: 79655869
Trimmed Sequence: CTGCTCCCCACTCTTGAGGCGCAGCACGACTGGTACGGACGTACAGGGGATCATGCCGATGTCTGTTATAACTAAATCCACCAGGTCTGGGGGGGTCACGTCGTACACCAGGTTCAGCAGCCGCAGGGACGAGTTCTTTTGCCAATTCCTTAGGGGACACCGTCCCTTCCTGCTCAAGATCAGCTCGTCCGGGTCATCCAGCACATTGAACACAAAGGAGTCAGTCTGAACTTTCTCACAGAACTTGTAGGTTTCACAGCACACCAGGACTGGGACATTGTGGGCTTTAGCTACCAAAGCAATCTGAGAGGTGCCCACGCGGGACATTACATAGCCATTAGCAAGAAGGGCATGTGCCCCTAGAAACACCTTGGAGACCTCGGGGAGAATGTAGGAGATGGCTGGGATCATAATGTACGTGCATTGGATTCCACAATTCACAAGTCATCTCAATGTCTCTCGTCCCTCTAGCCGTGGGCCGCTGTCCCACTACATGACACGAAATTACTTCCCGTTCCTGTTGAGCTTCTTGTAGTGTAGGTGTCACCAATGAGGAAGCGCCATCAAACTAGTATGACGTCGGCCCTCCTAAACCTCTCTCCTGCAAATTTAGAAGATATCGGACGCTCCCAGCAGGAATTTTTCATGCATGAAACGAGCGCAATCCCGGAAAAGGAGGGGAAGGGGTGAAACATGAGGGGGGTTGTGATGGGAGTAATTATGTAGGAGGGGGGGGGGGATGGGAAAGAAGGAATGGTGGGTTATTT
Full Trace Sequence: GGGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCTCCCCACTCTTGAGGCGCAGCACGACTGGTACGGACGTACAGGGGATCATGCCGATGTCTGTTATAACTAAATCCACCAGGTCTGGGGGGGTCACGTCGTACACCAGGTTCAGCAGCCGCAGGGACGAGTTCTTTTGCCAATTCCTTAGGGGACACCGTCCCTTCCTGCTCAAGATCAGCTCGTCCGGGTCATCCAGCACATTGAACACAAAGGAGTCAGTCTGAACTTTCTCACAGAACTTGTAGGTTTCACAGCACACCAGGACTGGGACATTGTGGGCTTTAGCTACCAAAGCAATCTGAGAGGTGCCCACGCGGGACATTACATAGCCATTAGCAAGAAGGGCATGTGCCCCTAGAAACACCTTGGAGACCTCGGGGAGAATGTAGGAGATGGCTGGGATCATAATGTACGTGCATTGGATTCCACAATTCACAAGTCATCTCAATGTCTCTCGTCCCTCTAGCCGTGGGCCGCTGTCCCACTACATGACACGAAATTACTTCCCGTTCCTGTTGAGCTTCTTGTAGTGTAGGTGTCACCAATGAGGAAGCGCCATCAAACTAGTATGACGTCGGCCCTCCTAAACCTCTCTCCTGCAAATTTAGAAGATATCGGACGCTCCCAGCAGGAATTTTTCATGCATGAAACGAGCGCAATCCCGGAAAAGGAGGGGAAGGGGTGAAACATGAGGGGGGTTGTGATGGGAGTAATTATGTAGGAGGGGGGGGGGGATGGGAAAGAAGGAATGGTGGGTTATTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCTCCCCACTCTTGA