ORFeome > eif2d ORF1 – XORFeome v1.0

eif2d ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif2d
Gene ID: 947285
Gene Page ID: 947278
ORF Xenbase ID: 17273871

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127431
Original XGC clone length: 1752

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ837571
dbEST ID: 79655273
Trimmed Sequence: ATGTTTGCGAAGAATTTTAGGGTCAAGTCAAATACAGCCATAAAGGGATCGGACAGGAGGAAGCTGCGAGCAGATATAAGTTCTGCATTTCCTCCTCTTACTACAGACAAACTTTCTGAGTTGATGCCATCTAAAGAGGAGCTGAATGTTGTAAAAGTATATCTACACAAAGGAGACGCAGTGACGTTATATGTCCACAGCCGAAACCCAGTTATGTTTGAGCTGGAGAGAAACCTCTATCCAACAGTTTATACTTTGTGGAAGTATCCAGATCTTCTCCCAGCATTCACCACATGGCCACCTGTCTTGGAGAAAATGGCAGGTGGAGCAGATCTGATGCTGCCTGGTGTTGTTGTCCCCCCTTGAAGGTCCTCTACATATACAACAAAGTAGCCTATGTGCCATCTCCTTGGTGGGTCGCAGGACAGGGATACCTTTTATCATGGAAAATGAAATAAACTCACAACATTAGTGAACAATATATTGCATCAAAGAGGAAACTAATACAAACTATAAGTCTATGACTTTACGTCCTAACGAATCACTCTGTGGCAAAGCAAAGAACGCGGTTACTGCTAATCTGTAGACAGTTGACGCACGTTTCTAAAGTCTGTGATAAAAAGATTAATGGGCAAAAAGGGGACGAAGGGTGGTGCTGGGCAGTCATCATAATAAATGGAAAAAAAAAAAAAGATTTCTCGCGAAACAAAAGATGGAAATTGGAGGAAGAGAGGGTGCGGGAGCAAAATAGGAGTGAAAAGAAAAAGCAGTTAAAATAAATGTTGTCATTGATATAAAAAGACATT
Full Trace Sequence: CGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTGCGAAGAATTTTAGGGTCAAGTCAAATACAGCCATAAAGGGATCGGACAGGAGGAAGCTGCGAGCAGATATAAGTTCTGCATTTCCTCCTCTTACTACAGACAAACTTTCTGAGTTGATGCCATCTAAAGAGGAGCTGAATGTTGTAAAAGTATATCTACACAAAGGAGACGCAGTGACGTTATATGTCCACAGCCGAAACCCAGTTATGTTTGAGCTGGAGAGAAACCTCTATCCAACAGTTTATACTTTGTGGAAGTATCCAGATCTTCTCCCAGCATTCACCACATGGCCACCTGTCTTGGAGAAAATGGCAGGTGGAGCAGATCTGATGCTGCCTGGTGTTGTTGTCCCCCCTTGAAGGTCCTCTACATATACAACAAAGTAGCCTATGTGCCATCTCCTTGGTGGGTCGCAGGACAGGGATACCTTTTATCATGGAAAATGAAATAAACTCACAACATTAGTGAACAATATATTGCATCAAAGAGGAAACTAATACAAACTATAAGTCTATGACTTTACGTCCTAACGAATCACTCTGTGGCAAAGCAAAGAACGCGGTTACTGCTAATCTGTAGACAGTTGACGCACGTTTCTAAAGTCTGTGATAAAAAGATTAATGGGCAAAAAGGGGACGAAGGGTGGTGCTGGGCAGTCATCATAATAAATGGAAAAAAAAAAAAAGATTTCTCGCGAAACAAAAGATGGAAATTGGAGGAAGAGAGGGTGCGGGAGCAAAATAGGAGTGAAAAGAAAAAGCAGTTAAAATAAATGTTGTCATTGATATAAAAAGACATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGCGAAGAATTTTAGGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837570
dbEST ID: 79655272
Trimmed Sequence: TTTCTTTTTACCAAATTTAGCCAGGTCCAGTCCAGCAATGTATTTGCGAGGTATTTTAAAGTCTTCAAGTAGTAGTTTTCCAACCTGAGACACCTGGTTGCCCTGTATCTGCACTTGCACTCTTTCTTTAGACCCTGGGATAGCTGTGCACGTGGAACTGGCCTGAACACGCTGCTGCAGCATGTTTCCCACTGAAGAAGGATCTAGTCCATACAGCTCCAGATTTTTAATTATTGTCGCCTTTTTATTTGATCCCCTCTGGACCACACTGATATCAATTGGGTCAATGTTTCCTTTTCGTATAAAGGATGGTCGACCAGGGATCGTCACTTGATGGAAAGGCTGCATCTTTTCCAGACACCTTGAGAGAAGGTCATCCCATTTCAGAATGAAAATGTCATTGTGCTCCGATTTTTCAAGAACGCAATCACACACAACTGGGTTAAAAATCACGAATTTTTTTTATTTTAATTGACAAACTGCTTGGATTTGACATATAGGAAAAAGAAGATTCTACCATCCCTTTGAGAGACGAAGGGACATGCTTTTTGCCAGGTCCGCTGTAAAAATGGTGGAAGCATGTAGAAACAAGAAGGTGATAGCGGCGGGACGGGGAGCGGCGGGGCAAGGGGAGGGAGGAGGGGTAAGGTGAAGAGAAAGCAGAGGGGAATTCGAGAGGGGGGGGCGGGGGTGGGGAGGAGGAAGGGGAAGAAGTGGTAGAGGCGAAAACCAGTGAAGAAAAGCGAGGAGAGCAACACTATCAGGAGGTG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTTTTACCAAATTTAGCCAGGTCCAGTCCAGCAATGTATTTGCGAGGTATTTTAAAGTCTTCAAGTAGTAGTTTTCCAACCTGAGACACCTGGTTGCCCTGTATCTGCACTTGCACTCTTTCTTTAGACCCTGGGATAGCTGTGCACGTGGAACTGGCCTGAACACGCTGCTGCAGCATGTTTCCCACTGAAGAAGGATCTAGTCCATACAGCTCCAGATTTTTAATTATTGTCGCCTTTTTATTTGATCCCCTCTGGACCACACTGATATCAATTGGGTCAATGTTTCCTTTTCGTATAAAGGATGGTCGACCAGGGATCGTCACTTGATGGAAAGGCTGCATCTTTTCCAGACACCTTGAGAGAAGGTCATCCCATTTCAGAATGAAAATGTCATTGTGCTCCGATTTTTCAAGAACGCAATCACACACAACTGGGTTAAAAATCACGAATTTTTTTTATTTTAATTGACAAACTGCTTGGATTTGACATATAGGAAAAAGAAGATTCTACCATCCCTTTGAGAGACGAAGGGACATGCTTTTTGCCAGGTCCGCTGTAAAAATGGTGGAAGCATGTAGAAACAAGAAGGTGATAGCGGCGGGACGGGGAGCGGCGGGGCAAGGGGAGGGAGGAGGGGTAAGGTGAAGAGAAAGCAGAGGGGAATTCGAGAGGGGGGGGCGGGGGTGGGGAGGAGGAAGGGGAAGAAGTGGTAGAGGCGAAAACCAGTGAAGAAAAGCGAGGAGAGCAACACTATCAGGAGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTTTTACCAAATTTAGCCA