ORFeome > eif2s3 ORF1 – XORFeome v1.0

eif2s3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif2s3
Gene ID: 986368
Gene Page ID: 986362
ORF Xenbase ID: 17273889

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043966
Original XGC clone length: 1419

Human orthology & disease relationships

NCBI Entrez ID: 1968
Ensembl gene IDs: ENSG00000130741
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11015
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGGGCACAATAATATGTATTTATTATATTTTCACTCGAGTATATGTAGACCGTGCTCTCTCTTCGCCACAATATGTAGATAGACACGAGCGTCTTTTTTATATGAGCGCCCTCTTTTGTGACACAAAGAAAGTGTGCTACCACCAGTGACAATTGGAGCACATGGTCCTCCGCCTCTGTTGCCTCGACCTAGCCCGGTGTTACATGACCGCACGATGCTCCCACCCAGCGTCTACCTGAGGCTGCGTAGAGAAGATGCATCGTACCGTAATCATATATCCCGCGTCCTTGTTTCGCAAGGCATCGACGGCTGCGCGGGCGAGGACGCGACCCTTCATCTTGTCACGCGGACAGGCTATAAATATTCCCCACAGCGGAGACACCACCAGGATGGTGTGTTACTGAGATAGAGACAGGAGTGTCCTCTAAACACCATATTCTGTGTGACTCTACCTTATCACAGCGGAATCAGCGATGATGCCACTGGTGCATCGGCGGTGCGTAATCACTGCGTAACACGCGCATAATCTTATAAAGAATCGGGATTCTTGGACGTAAGTAGTAATTCTCTTTCGGCGAGCCGTGACTGCTCAGTGGACTGGACAGTAAAAGCGCGTTCTTCGACAAGGGTGTCTCTCACCCAGATATACACCTCCCATGCGGAAAGAAGACTACTGTAGAACTACATTCTATACGACGTGTGGCAAATTTACGCACGCGTCGCCCACGAGATAGCTTCCTACCTGTCTATGTGGTTGGTGACCAACTCTAACTAGCCGGTTGCCTCCGCCCCGAGAGTGGCGGCACCCGGTCTTGCTCTTTATATTGGTGCAGAAGATGGTACGGCGACAACATAACACAACCACATAGAAAATCATAGAAGAATTAGCGGTGGCGAGTGCACAAGTTGTACTATCATCTTTCGCGTTATGTGGGATCCTGTCCATATATGGAAATCAGTGCGATTTTGTTTGTGTTGAGACCCGAGCCATAAACAAAACAGAACCAAAGAAAGGGAAAAACGACGCTCCTGTGTTCGCGAGTGAGAGGCGAGGGGGGCACCGCAGGGGGCCACTACAGCCCCTCCCTTTGCTGGGACCCCCCTTTTCTGACCAGAGAAAAATAGAAGGAAGGCGGTGGGGAGAGGAAAAAAAAAATATAAAGGGGTACACCTCTCGGGAGGGCCCCCCGTGGACCAGCCCCTCCCTCTATAATTTTCGCCCCCACGCCCCCACCCACTCCCTCCGCCCCCCCCCCCTCCAATAATATAACACACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGCGACGAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829612
dbEST ID: 79647314
Trimmed Sequence: GTCATCTTCTACTGTTGGCTTGATTGTCACTCCTCGTCTAATCTGGCCCCATCCAATCAAACGCCAATGTTTTTCCACTCTTCGGCTAAGGGCAATTTTCTCTCCTACTTCTGTGCACACTGGATTTGTCAGGACAATTTTAGCCAAATCAGCTTTGACAGCATTTACACGACCACCAGTGGACAAAGAGCCAATGTTGACCATCAGAACCTCATTCTTAGATAGCTTTTGTACCTTCGCAGCCTTCTTATCCCCCTCCATGCGCACACCAAGAAGTCGTCGCAAAAGGAAGTAAGAGATTTCCAGCTCAGTGAAAATTTCAGGCAGAGCACCAACTGCTCCTAAAACCTGACCCACCATACGATCAGCGCGGCACAAGGTTGGATCAATCTTGGTACCAACACCTATAAGGCCCCCAGGAGCTGCATATTGTAGATCATTGTGTTCTGCAAACAAAGACACAATTTTGGAAAAAATTGGCTTGCACATGAGTTTCCCTTCGCTGTCTTTTGAGACAATTCCAGGCCGAACTTCAATTTCTTGCCCCACCTTTAATACCCCTTTAAGAGTACTGCCACCAGCCACACCACCTTTAAGGTCATCAACTTCACATTCCTGGCTTGTTGACATCAAAAGATCTNATAACGATGAGCCTGGGCTCAGAAAATGAAGTCTCGTGGAAGGCCCAGGGATTTTCTTTGACATGTATTCCCCAAACTACCTTCCAAATGGTACCTTAACTTGACCAAAAAATTGGAAAAAAAAAAGGGGCCCCCT
Full Trace Sequence: GACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCATCTTCTACTGTTGGCTTGATTGTCACTCCTCGTCTAATCTGGCCCCATCCAATCAAACGCCAATGTTTTTCCACTCTTCGGCTAAGGGCAATTTTCTCTCCTACTTCTGTGCACACTGGATTTGTCAGGACAATTTTAGCCAAATCAGCTTTGACAGCATTTACACGACCACCAGTGGACAAAGAGCCAATGTTGACCATCAGAACCTCATTCTTAGATAGCTTTTGTACCTTCGCAGCCTTCTTATCCCCCTCCATGCGCACACCAAGAAGTCGTCGCAAAAGGAAGTAAGAGATTTCCAGCTCAGTGAAAATTTCAGGCAGAGCACCAACTGCTCCTAAAACCTGACCCACCATACGATCAGCGCGGCACAAGGTTGGATCAATCTTGGTACCAACACCTATAAGGCCCCCAGGAGCTGCATATTGTAGATCATTGTGTTCTGCAAACAAAGACACAATTTTGGAAAAAATTGGCTTGCACATGAGTTTCCCTTCGCTGTCTTTTGAGACAATTCCAGGCCGAACTTCAATTTCTTGCCCCACCTTTAATACCCCTTTAAGAGTACTGCCACCAGCCACACCACCTTTAAGGTCATCAACTTCACATTCCTGGCTTGTTGACATCAAAAGATCTNATAACGATGAGCCTGGGCTCAGAAAATGAAGTCTCGTGGAAGGCCCAGGGATTTTCTTTGACATGTATTCCCCAAACTACCTTCCAAATGGTACCTTAACTTGACCAAAAAATTGGAAAAAAAAAAGGGGCCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCTTCTACTGTTGGCT