ORFeome > eif3e ORF4 – XORFeome v1.0

eif3e ORF4 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif3e
Gene ID: 946253
Gene Page ID: 946245
ORF Xenbase ID: 17273937

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128927
Original XGC clone length: 1341

Human orthology & disease relationships

NCBI Entrez ID: 3646
Ensembl gene IDs: ENSG00000104408
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 181000,219500,400042,603896,608971,609532

Library Location

Plate ID: GDExl11092
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ838970
dbEST ID: 79656672
Trimmed Sequence: ATGGCGGACTACGACTTAACCACGAAGATCGCCCAGTTCTTGGACCGGCACTTGGTCTTTCCGCTGCTTGAATTCTTATCCGTGAAAGAGATTTACAATGAAAAGGAATTACTTCACGGGAAGCTGGACCTGCTCAGCGATACCAACATGGTTGACTTTGCCATGGACGTATACAAGAACCTTTATGCAGATAAAGAAATCCCTCTCGCTTTGAGGGAAAAGAGGACCACGGTGGTTGCACAACTGAAACAGCTGCAGGCAGAAACTGAGCCCATTGTTAAAATGTTTGAGGATCCAGAGACCACTCGCCAGATGCAGTCCACCAGAGATGGCCGCATGCTGTTTGATCACCTTGCTGAAAAACATGGGTTCAGACAGGAATACCTGGATACTCTTTACAGATATGCAAAGTTTCAGTATGAATGTGGCAACTATTCTGGAGCTGCTGAGTACTTGTACTTTTTCAGAGTGCTGGTTCCATCTACAGACCGAAACGCTCTCAGTTCTCTCTGGGGAAAGCTGGCATCAGAAATTTTGATGCAGAATTGGGATGCTGCCATGGAAGATCTTACCAGGCTTAAAGAGACGATCGACAATAATACTGTCAGTTCCCCACTCCAGTCTCTTCAGCACAGGACATGGCTTATACATTGGGTCTCTGTTTGTATTCTTTCATCACCCAAAAGGAAGAGGACACATCATTGACCTGTTCCTCTATCAGCCCTCATACCTGAATGCCATTCAGACTATGTGTTCCGCACATTCTTCCGATATCTGAACACGGGCCGTGATCACCAAACCAAAGGATG
Full Trace Sequence: CTGGGNTCTAGCTCGGGACCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACTACGACTTAACCACGAAGATCGCCCAGTTCTTGGACCGGCACTTGGTCTTTCCGCTGCTTGAATTCTTATCCGTGAAAGAGATTTACAATGAAAAGGAATTACTTCACGGGAAGCTGGACCTGCTCAGCGATACCAACATGGTTGACTTTGCCATGGACGTATACAAGAACCTTTATGCAGATAAAGAAATCCCTCTCGCTTTGAGGGAAAAGAGGACCACGGTGGTTGCACAACTGAAACAGCTGCAGGCAGAAACTGAGCCCATTGTTAAAATGTTTGAGGATCCAGAGACCACTCGCCAGATGCAGTCCACCAGAGATGGCCGCATGCTGTTTGATCACCTTGCTGAAAAACATGGGTTCAGACAGGAATACCTGGATACTCTTTACAGATATGCAAAGTTTCAGTATGAATGTGGCAACTATTCTGGAGCTGCTGAGTACTTGTACTTTTTCAGAGTGCTGGTTCCATCTACAGACCGAAACGCTCTCAGTTCTCTCTGGGGAAAGCTGGCATCAGAAATTTTGATGCAGAATTGGGATGCTGCCATGGAAGATCTTACCAGGCTTAAAGAGACGATCGACAATAATACTGTCAGTTCCCCACTCCAGTCTCTTCAGCACAGGACATGGCTTATACATTGGGTCTCTGTTTGTATTCTTTCATCACCCAAAAGGAAGAGGACACATCATTGACCTGTTCCTCTATCAGCCCTCATACCTGAATGCCATTCAGACTATGTGTTCCGCACATTCTTCCGATATCTGAACACGGGCCGTGATCACCAAACCAAAGGATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACTACGACTTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838969
dbEST ID: 79656671
Trimmed Sequence: ATAGAATCCAGAATCCTGAGCTGCCCAGGTAGGTGCCTCAGTTCTGCTATTCGTGTTCATTTTCTTCTCAATATTCATTGCCAGCATTTGGCTACGGAACGCAAGGCTCTTTGTCTTTTCAATCACTTGCTGATAGGGAGAGACGGCATTGTTCCCCATAACCACATGGCCCAGTTTGGAATCTATCTTGGCGTCCAGTCTTGCATTACGAATTAAATTGACAATCCACCTTTCAGCTTCTTCCGGAGTCATATTCAGTTTGTCGGCCAACATGCTGATGCTTATACACTGATGGATGCGACAGAAGGTCTCAAATATAAAGAGTCTGGCATTTTCTATGAAGTCTTCTAGGCAGGCCACAAGGAAGAAGTCATTTACCAGCACCGATTCACATTCTCTCAATTTTTTCTGTGCTCCATCAAAATCAAAGTTGACGTATAAGCATTCCACAAACTCAGTAATGGGATCTTTGTAAGTGTAGGATTCCTGTTGGATGACCTTAACCAGATCTTTCAAGACTTGTCTTCGTTTCCTCACATCTTTGTTGGTGATCACGGCCGTTGTCAGATATCGGAAAATGTGCGGACACATATTCTGAATGGCATTCAGGTAATGAGGCTGATAGAGGAACAAGGCATTGATGGTGTCTCTTTCTTTTGGGGGAATGAAAAAATACAAAACCAAGACCAATGGAAAAAGCCAGGGTCCGGTGGTGGAAAAAAACTGGAAGGGGGGGGAACATGAAAAATAATTAAATTGGC
Full Trace Sequence: AAGCAGGCTATCGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGAATCCAGAATCCTGAGCTGCCCAGGTAGGTGCCTCAGTTCTGCTATTCGTGTTCATTTTCTTCTCAATATTCATTGCCAGCATTTGGCTACGGAACGCAAGGCTCTTTGTCTTTTCAATCACTTGCTGATAGGGAGAGACGGCATTGTTCCCCATAACCACATGGCCCAGTTTGGAATCTATCTTGGCGTCCAGTCTTGCATTACGAATTAAATTGACAATCCACCTTTCAGCTTCTTCCGGAGTCATATTCAGTTTGTCGGCCAACATGCTGATGCTTATACACTGATGGATGCGACAGAAGGTCTCAAATATAAAGAGTCTGGCATTTTCTATGAAGTCTTCTAGGCAGGCCACAAGGAAGAAGTCATTTACCAGCACCGATTCACATTCTCTCAATTTTTTCTGTGCTCCATCAAAATCAAAGTTGACGTATAAGCATTCCACAAACTCAGTAATGGGATCTTTGTAAGTGTAGGATTCCTGTTGGATGACCTTAACCAGATCTTTCAAGACTTGTCTTCGTTTCCTCACATCTTTGTTGGTGATCACGGCCGTTGTCAGATATCGGAAAATGTGCGGACACATATTCTGAATGGCATTCAGGTAATGAGGCTGATAGAGGAACAAGGCATTGATGGTGTCTCTTTCTTTTGGGGGAATGAAAAAATACAAAACCAAGACCAATGGAAAAAGCCAGGGTCCGGTGGTGGAAAAAAACTGGAAGGGGGGGGAACATGAAAAATAATTAAATTGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGAATCCAGAATCCTGAGC