ORFeome > eif4a2 ORF1 – XORFeome v1.0

eif4a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif4a2
Gene ID: 978558
Gene Page ID: 978553
ORF Xenbase ID: 17274009

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041252
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID: 1974
Ensembl gene IDs: ENSG00000156976
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 181000,219500,400042,603896,608971,609532

Library Location

Plate ID: GDExl11009
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ823764
dbEST ID: 79641466
Trimmed Sequence: ATGGTTTTGAAAAGCCGTCGGCGATACAACAAAGGGCAATCATTCCATGTATCAAAGATACAGAAAGTTATTTTGGCGTTGGGTGACTATATGGGAGCAACGTGTCATGCTTGCATTGGAGGCACAAACGTTCGAAATGAGATGCAGAAGCTACAGGCTGAGGCACCTCACATTGTTGTTGGAACGCCCGGGCGAGTTTTCGACATGTTAAATCGGAGATATCTTTCTCCCAAATGGATCAAGATGTTTGTTTTAGACGAGGCAGATGAAATGCTGAGTCGTGGATTCAAGGATCAGATCTATGAAATTTTTCAGAAGTTGAGCACCAACATTCAGGTTGTCCTGCTTTCTGCCACAATGCCAACAGATGTGTTGGAAGTGACAAAGAAATTCATGAGGGATCCAATTCGCATCTTGGTCAAAAAAGAAGAGTTAACCCTGGAGGGTATTAAACAGTTCTACATTAATGTTGAACGAGAGGAATGGAAGCTGGACACACTCTGTGACTTGTATGAGACATTAACAATTACACAGGCTGTAATTTTCCTCAATACAAGAAGAAAGGTTGACTGGCTTACAGAGAAAATGCATTCAAGGGACTTTACAGTCTCTGCTCTGCATGGTGACATGGACCAGAAAGAGAGGGATGTTATTATGAAGGGAATTTCGTTCTGGATCGAGTAGAGTGTTAATCACCACAGACTTGCTGGCTCGTGGCATAGATGTGCAGCAAGTTTCCCCTGGTATAAATTACGACCTANCTACCCATCGTGAAAACTAACATCACAGTTTGCCCAC
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTTTGAAAAGCCGTCGGCGATACAACAAAGGGCAATCATTCCATGTATCAAAGATACAGAAAGTTATTTTGGCGTTGGGTGACTATATGGGAGCAACGTGTCATGCTTGCATTGGAGGCACAAACGTTCGAAATGAGATGCAGAAGCTACAGGCTGAGGCACCTCACATTGTTGTTGGAACGCCCGGGCGAGTTTTCGACATGTTAAATCGGAGATATCTTTCTCCCAAATGGATCAAGATGTTTGTTTTAGACGAGGCAGATGAAATGCTGAGTCGTGGATTCAAGGATCAGATCTATGAAATTTTTCAGAAGTTGAGCACCAACATTCAGGTTGTCCTGCTTTCTGCCACAATGCCAACAGATGTGTTGGAAGTGACAAAGAAATTCATGAGGGATCCAATTCGCATCTTGGTCAAAAAAGAAGAGTTAACCCTGGAGGGTATTAAACAGTTCTACATTAATGTTGAACGAGAGGAATGGAAGCTGGACACACTCTGTGACTTGTATGAGACATTAACAATTACACAGGCTGTAATTTTCCTCAATACAAGAAGAAAGGTTGACTGGCTTACAGAGAAAATGCATTCAAGGGACTTTACAGTCTCTGCTCTGCATGGTGACATGGACCAGAAAGAGAGGGATGTTATTATGAAGGGAATTTCGTTCTGGATCGAGTAGAGTGTTAATCACCACAGACTTGCTGGCTCGTGGCATAGATGTGCAGCAAGTTTCCCCTGGTATAAATTACGACCTANCTACCCATCGTGAAAACTAACATCACAGTTTGCCCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTTTGAAAAGCCGTCG

Sequences - 3ʹ (reverse) EST

Accession: JZ829073
dbEST ID: 79646775
Trimmed Sequence: ACTGTGAATGTAGTTTTCACGATTGGTAGGTAGGTCGTAATTTATAACCAGGGAAACTTGCTGCACATCTATGCCACGAGCCAGCAAGTCTGTGGTGATTAACACTCTACTCGATCCAGAACGAAATTCCCTCATAATAACATCCCTCTCTTTCTGGTCCATGTCACCATGCAGAGCAGAGACTGTAAAGTCCCTTGAATGCATTTTCTCTGTAAGCCAGTCAACCTTTCTTCTTGTATTGAGGAAAATTACAGCCTGTGTAATTGTTAATGTCTCATACAAGTCACAGAGTGTGTCCAGCTTCCATTCCTCTCGTTCAACATTAATGTAGAACTGTTTAATACCCTCCAGGGTTAACTCTTCTTTTTTGACCAAGATGCGAATTGGATCCCTCATGAATTTCTTTGTCACTTCCAACACATCTGTTGGCATTGTGGCAGAAAGCAGGACAACCTGAATGTTGGTGCTCAACTTCTGAAAAATTTCATAGATCTGATCCTTGAATCCACGACTCAGCATTTCATCTGCCTCGTCTAANACAAACATCTTGATCCATTTGGGAGAAAGATATCTCCGATTTAACATGTCGAAAACTCGCCCGGGCGTTCCACAACAATGTGAGGTGCCTCAGCCTGTAGCTTCTGCATCTCATTTCGAACGTTTGTGCCTCCCATGCAAGCCTGACACGTTTCTCCCCATATATTCACCCACCGCCCAAAATAACTTTCTGGAATCTTTTGATACATGGGAAAGGA
Full Trace Sequence: CTGACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGTGAATGTAGTTTTCACGATTGGTAGGTAGGTCGTAATTTATAACCAGGGAAACTTGCTGCACATCTATGCCACGAGCCAGCAAGTCTGTGGTGATTAACACTCTACTCGATCCAGAACGAAATTCCCTCATAATAACATCCCTCTCTTTCTGGTCCATGTCACCATGCAGAGCAGAGACTGTAAAGTCCCTTGAATGCATTTTCTCTGTAAGCCAGTCAACCTTTCTTCTTGTATTGAGGAAAATTACAGCCTGTGTAATTGTTAATGTCTCATACAAGTCACAGAGTGTGTCCAGCTTCCATTCCTCTCGTTCAACATTAATGTAGAACTGTTTAATACCCTCCAGGGTTAACTCTTCTTTTTTGACCAAGATGCGAATTGGATCCCTCATGAATTTCTTTGTCACTTCCAACACATCTGTTGGCATTGTGGCAGAAAGCAGGACAACCTGAATGTTGGTGCTCAACTTCTGAAAAATTTCATAGATCTGATCCTTGAATCCACGACTCAGCATTTCATCTGCCTCGTCTAANACAAACATCTTGATCCATTTGGGAGAAAGATATCTCCGATTTAACATGTCGAAAACTCGCCCGGGCGTTCCACAACAATGTGAGGTGCCTCAGCCTGTAGCTTCTGCATCTCATTTCGAACGTTTGTGCCTCCCATGCAAGCCTGACACGTTTCTCCCCATATATTCACCCACCGCCCAAAATAACTTTCTGGAATCTTTTGATACATGGGAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGTGAATGTAGTTTTCACGATT