ORFeome > eif4a3 ORF1 – XORFeome v1.0

eif4a3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eif4a3
Gene ID: 5773753
Gene Page ID: 5773452
ORF Xenbase ID: 17274015

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084859
Original XGC clone length: 1248

Human orthology & disease relationships

NCBI Entrez ID: 9775
Ensembl gene IDs: ENSG00000141543
Directly associated (OMIM) disease MIM numbers: 268305
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ839984
dbEST ID: 79657686
Trimmed Sequence: ATGGCGGCCGCAGCTGTTGCAGGAGTTGCCGGATTGACCAGCGGCGCAGGCCGCAAGCGGCTTTTACGGGAGGAGGATATGACTAAGGTGGAGTTCGAGACCAGCGAGGAGGTGGATGTAACGCCAACGTTTGATACGATGGGGCTGAGGGAAGACCTTCTGAGAGGCATCTATGCTTATGGATTTGAGAAACCATCGGCTATACAACAGAGGGCAATCAAGCAGATTATCAAAGGAAGGGATGTGATCGCACAATCACAGTCTGGTACAGGCAAAACAGCAACTTTTTGTGTTTCTGTGCTACAGTGTTTGGATATTCAGGTCCGTGAAACCCAAGCCTTGATTTTAGCACCCACCAGAGAGTTAGCAGGGCAAATTCAGAAGGTGTTGCTTGCTTTGGGGGACTACATGAATGTGCAGTGTCATGCGTGTATTGGAGGCACAAATGTTGGAGAGGATATCCGAAAATTGGATTATGGGCAGCACGTTGTTGCTGGAACACCAGGGCGTGTTTTTGATATGATTCGACGCAGAAGTTTAAGAACTCGGGCCATTAAAATGTTAGTGCTGGATGAAGCTGATGAAATGTTGAATAATGGTTTCAAGGAGCAAATTTATGATGTATACAGGTATCTGCCTCCAGCAACCCAAGTTTTGTTAATCAGTGGCACGCTGCCCCTTGAATTCCTGGAAATGACAATAAATTTATAAATGATTCCATC
Full Trace Sequence: CCAGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCGCAGCTGTTGCAGGAGTTGCCGGATTGACCAGCGGCGCAGGCCGCAAGCGGCTTTTACGGGAGGAGGATATGACTAAGGTGGAGTTCGAGACCAGCGAGGAGGTGGATGTAACGCCAACGTTTGATACGATGGGGCTGAGGGAAGACCTTCTGAGAGGCATCTATGCTTATGGATTTGAGAAACCATCGGCTATACAACAGAGGGCAATCAAGCAGATTATCAAAGGAAGGGATGTGATCGCACAATCACAGTCTGGTACAGGCAAAACAGCAACTTTTTGTGTTTCTGTGCTACAGTGTTTGGATATTCAGGTCCGTGAAACCCAAGCCTTGATTTTAGCACCCACCAGAGAGTTAGCAGGGCAAATTCAGAAGGTGTTGCTTGCTTTGGGGGACTACATGAATGTGCAGTGTCATGCGTGTATTGGAGGCACAAATGTTGGAGAGGATATCCGAAAATTGGATTATGGGCAGCACGTTGTTGCTGGAACACCAGGGCGTGTTTTTGATATGATTCGACGCAGAAGTTTAAGAACTCGGGCCATTAAAATGTTAGTGCTGGATGAAGCTGATGAAATGTTGAATAATGGTTTCAAGGAGCAAATTTATGATGTATACAGGTATCTGCCTCCAGCAACCCAAGTTTTGTTAATCAGTGGCACGCTGCCCCTTGAATTCCTGGAAATGACAATAAATTTATAAATGATTCCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCGCAGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839983
dbEST ID: 79657685
Trimmed Sequence: AATGAGATCAGCAACGTTCATTGGCATTTCATCAATCTGGGTCGAATAGTACTGCTCAATATCTCTTAAGATACGGATGTCATCATTCTTGACAAAGTTAATGGCAACACCCTTTCCTCCATATCTTCCTGATCGGCCAATTCTGTGAATGTACAATTCTCTGTTATTGGGAAGATCATAGTTGATAATCAAGGAGACCTGTGGCACATCCAATCCTCGGGCCCAGACGTCCGTTGATATGAGGACTCGGCTTGCACCAGATCGGAATTCTTTCATGATTGACTCTCTCTCCTTTTGGGGCATATCACCATGCATTGACGAAACGGTGAAATTTGCTTCTCTCATTTTCTCAGTCAACCAATCTACCTTTCTCTTGGTGTTGCAGAAGATTACAGCTTGTGTAATAGTCAAAGTATCATATAAATCACACAAAGTATCAAACTTCCACTCTTCTCTCTCCACTGCCACAAAAAACTGCTTGATGCCTTCCAGTGTCAACTCATCACGTTTCACAAGGATACGGATGGGATCAGTCATAAACTTATTGGTCATTTCCAGGATTTCATGTGGCAGCGTAGCACTGATTAAACAAACTTGTGTTGCCTGAGGCAGATACCTGTATACATCATAAATCTGCTCCCT
Full Trace Sequence: GGGGAGACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATGAGATCAGCAACGTTCATTGGCATTTCATCAATCTGGGTCGAATAGTACTGCTCAATATCTCTTAAGATACGGATGTCATCATTCTTGACAAAGTTAATGGCAACACCCTTTCCTCCATATCTTCCTGATCGGCCAATTCTGTGAATGTACAATTCTCTGTTATTGGGAAGATCATAGTTGATAATCAAGGAGACCTGTGGCACATCCAATCCTCGGGCCCAGACGTCCGTTGATATGAGGACTCGGCTTGCACCAGATCGGAATTCTTTCATGATTGACTCTCTCTCCTTTTGGGGCATATCACCATGCATTGACGAAACGGTGAAATTTGCTTCTCTCATTTTCTCAGTCAACCAATCTACCTTTCTCTTGGTGTTGCAGAAGATTACAGCTTGTGTAATAGTCAAAGTATCATATAAATCACACAAAGTATCAAACTTCCACTCTTCTCTCTCCACTGCCACAAAAAACTGCTTGATGCCTTCCAGTGTCAACTCATCACGTTTCACAAGGATACGGATGGGATCAGTCATAAACTTATTGGTCATTTCCAGGATTTCATGTGGCAGCGTAGCACTGATTAAACAAACTTGTGTTGCCTGAGGCAGATACCTGTATACATCATAAATCTGCTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATGAGATCAGCAACGTTCATTGG