ORFeome > elavl4 ORF1 – XORFeome v1.0

elavl4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: elavl4
Gene ID: 948214
Gene Page ID: 948209
ORF Xenbase ID: 17274093

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043735
Original XGC clone length: 1188

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ823786
dbEST ID: 79641488
Trimmed Sequence: ATGGTGATGATAATTAGCACCATGGAACCTCAGGTGTCGAATGGCCCAACTTCCAATACAAGCAATGGCCCCTCCAGTAACAGCAGGAACTGTCCTTCTCCCATGCAGACAGGCGCAGCCACAGATGACAGCAAAACAAACCTCATAGTCAACTACTTGCCGCAAAATATGACGCAGGAGGAATTCAGGAGTCTATTTGGCAGCATCGGAGAGATAGAATCCTGTAAACTAGTGCGGGATAAAATTACAGGCACACAATTCGAGGAAAACTTCAAGGATTTAGCCACTGGCACAAAATGGAAACCCCTTACTGAAGAGGGCCCTATCTTTGGGAAAGGGCAGAGCCTTGGTTATGGATTTGTTAACTACATTGATCCAAAGGATGCAGAAAAAGCCATTAACACATTAAATGGACTCCGACTACAAACCAAAACCATCAAGGTTTCCTATGCCCGCCCCAGCTCTGCATCAATCCGTGATGCTAACTTGTATGTAAGCGGCCTTCCAAAAACCATGACACAGAAAGAGCTGGAGCAGTTATTTTCACAGTATGGACGCATCATCACCTCAAGAATCTTAGTCGATCAAGTTACAGGTGTGTCCAGGGGAGTTGGGTTTATTCGTTTTGACAAGAGAATAGAAGCAGAGGAAGCCATAAAGGGATTGAATGGACAGAAGCCAAGTGGAGCCGCAGAACCATTACTGTGAAATTTGCCAACACCCCAGTCAGAAAACAAGCCAGGCATTACTTTCCCAACTCTACAAATCCCCCAACAGAACGTTTATCTTGGCCCCCTTCCTTCATTCAGGGCTCAAAAGAATTCAGGGC
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGATGATAATTAGCACCATGGAACCTCAGGTGTCGAATGGCCCAACTTCCAATACAAGCAATGGCCCCTCCAGTAACAGCAGGAACTGTCCTTCTCCCATGCAGACAGGCGCAGCCACAGATGACAGCAAAACAAACCTCATAGTCAACTACTTGCCGCAAAATATGACGCAGGAGGAATTCAGGAGTCTATTTGGCAGCATCGGAGAGATAGAATCCTGTAAACTAGTGCGGGATAAAATTACAGGCACACAATTCGAGGAAAACTTCAAGGATTTAGCCACTGGCACAAAATGGAAACCCCTTACTGAAGAGGGCCCTATCTTTGGGAAAGGGCAGAGCCTTGGTTATGGATTTGTTAACTACATTGATCCAAAGGATGCAGAAAAAGCCATTAACACATTAAATGGACTCCGACTACAAACCAAAACCATCAAGGTTTCCTATGCCCGCCCCAGCTCTGCATCAATCCGTGATGCTAACTTGTATGTAAGCGGCCTTCCAAAAACCATGACACAGAAAGAGCTGGAGCAGTTATTTTCACAGTATGGACGCATCATCACCTCAAGAATCTTAGTCGATCAAGTTACAGGTGTGTCCAGGGGAGTTGGGTTTATTCGTTTTGACAAGAGAATAGAAGCAGAGGAAGCCATAAAGGGATTGAATGGACAGAAGCCAAGTGGAGCCGCAGAACCATTACTGTGAAATTTGCCAACACCCCAGTCAGAAAACAAGCCAGGCATTACTTTCCCAACTCTACAAATCCCCCAACAGAACGTTTATCTTGGCCCCCTTCCTTCATTCAGGGCTCAAAAGAATTCAGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGATGATAATTAGCACCATG

Sequences - 3ʹ (reverse) EST

Accession: JZ829095
dbEST ID: 79646797
Trimmed Sequence: AGACTTGTGGGTTTTGTTGGTTTTAAAGGAAACTTGCAAAACTCTGTCACCCAGGCGATATCCATTAAGGCTGGCAATGGCCATTGCAGCTTCATCATAATTGGTCATTGTGACAAAGCCAAATCCCTTGCACTTGTTGGTGTTAAAGTCACGGATGACTTTCACATTGTTGACAGCCCCAAATGGGCCAAAAAGCTGCCACAGAACACTTTCATCGGAGTCAGGAGAGAGGTTGTAAACAAAGATGCACCAACCAGTACCCGTGTGCCCAGGGATGTTCATTCCCACCAGGCTTGTCATTCCATCGATGGTGATAGGAGAAAACCTCTTAACGCCATAGGCCATATTAAGCAAATTGTCCAGCCTGAATCTCTGAGCCTGATGATGAAGGGGGCCAGGATAACGTCTGTTGGGGGATTGGTAGAGTTGGGAAAGTAATGCCTGGCTTGTTTTCTGACTGGTGTTGTTGGCAAATTTCACAGTAATTGGTTCTGCGGCTCCACTTGGCTTCTGTCCATTCAATCCCTTTATGGCTTCCTCTGCTTCTATTCTCTTGTCNAAACGAATAAACCCAACTCCCCTGGACACACCTGTAACTTGATCGACTAAGAATCTTGAGGTGATGATGCGTCCATACTGTGAAAATAACTGCTCCAACCTCCTTTCTGTGTCAGGGGTTTTTGGGAAAGGCCGCTTAACAAACCAATTTTCCCACCCCCGGAATTTATTGCACAAATCTGGGGCCGGGCTAAGGGAAAAAACCCGTGGGAGGGT
Full Trace Sequence: CCGGTAATCAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACTTGTGGGTTTTGTTGGTTTTAAAGGAAACTTGCAAAACTCTGTCACCCAGGCGATATCCATTAAGGCTGGCAATGGCCATTGCAGCTTCATCATAATTGGTCATTGTGACAAAGCCAAATCCCTTGCACTTGTTGGTGTTAAAGTCACGGATGACTTTCACATTGTTGACAGCCCCAAATGGGCCAAAAAGCTGCCACAGAACACTTTCATCGGAGTCAGGAGAGAGGTTGTAAACAAAGATGCACCAACCAGTACCCGTGTGCCCAGGGATGTTCATTCCCACCAGGCTTGTCATTCCATCGATGGTGATAGGAGAAAACCTCTTAACGCCATAGGCCATATTAAGCAAATTGTCCAGCCTGAATCTCTGAGCCTGATGATGAAGGGGGCCAGGATAACGTCTGTTGGGGGATTGGTAGAGTTGGGAAAGTAATGCCTGGCTTGTTTTCTGACTGGTGTTGTTGGCAAATTTCACAGTAATTGGTTCTGCGGCTCCACTTGGCTTCTGTCCATTCAATCCCTTTATGGCTTCCTCTGCTTCTATTCTCTTGTCNAAACGAATAAACCCAACTCCCCTGGACACACCTGTAACTTGATCGACTAAGAATCTTGAGGTGATGATGCGTCCATACTGTGAAAATAACTGCTCCAACCTCCTTTCTGTGTCAGGGGTTTTTGGGAAAGGCCGCTTAACAAACCAATTTTCCCACCCCCGGAATTTATTGCACAAATCTGGGGCCGGGCTAAGGGAAAAAACCCGTGGGAGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTTGTGGGTTTTGTTGGTT