ORFeome > elf-1-prov ORF1 – XORFeome v1.0

elf-1-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253778
Gene Page ID:
ORF Xenbase ID: 17274105

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044973
Original XGC clone length: 1914

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ823793
dbEST ID: 79641495
Trimmed Sequence: ATGGCCACAGCCGTGCAACCAAATGAGCTGGTGTTTGAGTTTGCAAGCAATGTGATGGAGGATGAGCATCAGCTTGGAGACCCTTCTATTTTTCCAGCTGTCATTGTTGAGCACATTCCAAATGCAGATCTCCTGCACACCTACTCTGGTCTAACCTGTGTTGATGAACCAAACCATATGATCACAGAAAACTCATTGGATGTAGCAGAGGAACAGATTATTGAAGATGATGACCTCACTCTTACAGTTGAAACATCTTGCCTTTCAGTTGAAGCATCTTGTAACAGTGGCGATGAGACTATGGAGACAATTGAAGCTGCCGAGGCACTACTAAATATGGATTCACCTGATTCACCTATGCTGGATGAAAAAAGGCTTGCTAACATCTTTGGTTCAGCTGATGATGACCTCCTGATCAGTCCTATTACCCACGTCTCTGTCACTGTTGATGGAATCCCAGAGGTGGTGGAAATTAACCCGAACTTCTATGAAGAGAATCTAGAATCTAATTTACAGGAACAACCTAAGAGAAAAAAAGGGAGAAAACCAAGAAATCCTCGTCCTGAATCTCCCACCACCCCAAATATATGTGTCAAAAAGAAAAACAAAGATGGTAAAGGAAATACAATTTATTTGTGGGAGTTTTTGCTGGCTTTGCTTCAAGATAAAGCAACGTGCCCAAAGTACATTAAGTGGACACAGAGAGAAAAGGGCATTTTCAAACTGGTAGACTCGAAAGCTGTTTTCCAGACTGGTGGGGTAAACATTAAGAACAAGCCCTGACATGAAATTATGA
Full Trace Sequence: AATACTGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACAGCCGTGCAACCAAATGAGCTGGTGTTTGAGTTTGCAAGCAATGTGATGGAGGATGAGCATCAGCTTGGAGACCCTTCTATTTTTCCAGCTGTCATTGTTGAGCACATTCCAAATGCAGATCTCCTGCACACCTACTCTGGTCTAACCTGTGTTGATGAACCAAACCATATGATCACAGAAAACTCATTGGATGTAGCAGAGGAACAGATTATTGAAGATGATGACCTCACTCTTACAGTTGAAACATCTTGCCTTTCAGTTGAAGCATCTTGTAACAGTGGCGATGAGACTATGGAGACAATTGAAGCTGCCGAGGCACTACTAAATATGGATTCACCTGATTCACCTATGCTGGATGAAAAAAGGCTTGCTAACATCTTTGGTTCAGCTGATGATGACCTCCTGATCAGTCCTATTACCCACGTCTCTGTCACTGTTGATGGAATCCCAGAGGTGGTGGAAATTAACCCGAACTTCTATGAAGAGAATCTAGAATCTAATTTACAGGAACAACCTAAGAGAAAAAAAGGGAGAAAACCAAGAAATCCTCGTCCTGAATCTCCCACCACCCCAAATATATGTGTCAAAAAGAAAAACAAAGATGGTAAAGGAAATACAATTTATTTGTGGGAGTTTTTGCTGGCTTTGCTTCAAGATAAAGCAACGTGCCCAAAGTACATTAAGTGGACACAGAGAGAAAAGGGCATTTTCAAACTGGTAGACTCGAAAGCTGTTTTCCAGACTGGTGGGGTAAACATTAAGAACAAGCCCTGACATGAAATTATGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACAGCCGTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829102
dbEST ID: 79646804
Trimmed Sequence: TTGTGAATCAAATGCCCATTGGTCGTTTTCTTGTTTTATTTCCAATGGAGAAGGAAACCCGTTAGGACTGGCAACTACCAACACGCACGGGGGCTGATATTTCTGCTCAGTCTGCTCAGCAGTCTCTGGTGTTCCCTCCTGCAGAGCTTGAGTGGTAGATACAGGAAGAAGTGTCTGTTTGGTTTCAGGAGACTTGATTACAGATGTGATGACTGTTCCTGTAGCCTGGGTGAGCAGAGGTGAAGTGCTGGTGGAAAAGCTCATGACTGGAGTACTTGCACTGAAGGTTGGAGATGAAGGCAAACTGAGTGTTCCATTACAAAGACTCTGCACATTGCCGCTGAGAACCTGCTGTACCTGGCTTGGGCTCAAGACAATTGATGGAGGCGGCGAACCTGTTCTTTGGGGTTGTAGCACCATGTTTTCTTTAAGTATTGTCATAGGCGAAACTGAAGGCATGGCTTGTAGTATAAATTTTTGTGACCCTGCTCCCGTTACTGGGTCTGTGCTTGTTATGACTGTGGTGAGAGGCACTGTTTGGAGTGTTACTGCATGCAGCTGCTGATTTCCTGCAGAGACCACAACTGGTACTTGTCCTGGAGACTGTATAGTTCTTACAGTCTGAGCTCCAGGCAAGCTGTCATTTTGAATTGTGCAAAGTATGGCTTGTTCTGAAATTGCTTGTCCGGGCTGCATTAAATGCACTGTCCCGATATAACCTAAATTTGGGTGTGGCCTGTTAATACCTGGAAA
Full Trace Sequence: CCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTGAATCAAATGCCCATTGGTCGTTTTCTTGTTTTATTTCCAATGGAGAAGGAAACCCGTTAGGACTGGCAACTACCAACACGCACGGGGGCTGATATTTCTGCTCAGTCTGCTCAGCAGTCTCTGGTGTTCCCTCCTGCAGAGCTTGAGTGGTAGATACAGGAAGAAGTGTCTGTTTGGTTTCAGGAGACTTGATTACAGATGTGATGACTGTTCCTGTAGCCTGGGTGAGCAGAGGTGAAGTGCTGGTGGAAAAGCTCATGACTGGAGTACTTGCACTGAAGGTTGGAGATGAAGGCAAACTGAGTGTTCCATTACAAAGACTCTGCACATTGCCGCTGAGAACCTGCTGTACCTGGCTTGGGCTCAAGACAATTGATGGAGGCGGCGAACCTGTTCTTTGGGGTTGTAGCACCATGTTTTCTTTAAGTATTGTCATAGGCGAAACTGAAGGCATGGCTTGTAGTATAAATTTTTGTGACCCTGCTCCCGTTACTGGGTCTGTGCTTGTTATGACTGTGGTGAGAGGCACTGTTTGGAGTGTTACTGCATGCAGCTGCTGATTTCCTGCAGAGACCACAACTGGTACTTGTCCTGGAGACTGTATAGTTCTTACAGTCTGAGCTCCAGGCAAGCTGTCATTTTGAATTGTGCAAAGTATGGCTTGTTCTGAAATTGCTTGTCCGGGCTGCATTAAATGCACTGTCCCGATATAACCTAAATTTGGGTGTGGCCTGTTAATACCTGGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTGAATCAAATGCCCATTGGT