ORFeome > elmod2 ORF1 – XORFeome v1.0

elmod2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: elmod2
Gene ID: 6078529
Gene Page ID: 998864
ORF Xenbase ID: 17274153

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059331
Original XGC clone length: 879

Human orthology & disease relationships

NCBI Entrez ID: 255520
Ensembl gene IDs: ENSG00000179387
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 607196

Library Location

Plate ID: GDExl11020
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ824746
dbEST ID: 79642448
Trimmed Sequence: ATGATTTCCTTCATCTGGCACTACTTCTACAGCAACTACTTTCGGTTTTGGCTGAAATGGGTTCTCAGACAAATAAGTGGGAAATGTGAGTTGCAGAGAATTTGTGATGGAACTAAGGATGGAGCCAGCCGAACACACAGGATAGAATACTCATTGGAACATTCAAAATTTAAGGTACTGCGACATGCCATAAATATTCCAGAGGAGCAGGTGGACCGGTATGTAGCTGATATAGTAAAAGAAAAGAAGATCATTTTGGAAAAGGATAAAAGATTTGAGATAAATCTGAGGATTTGTTTGTTACAGATTTCTGGCTACAAGAAGCTCTATTTAGATGTGGAAAATTTAAGAAAGCAGTCTTATGACTCTGATAATAATTATCACGAACAGCAACTACTAGAGCTCTGGGACTTACTCATGCCTCATGAAAAGCTAAACAACAGAGTCACTAAACAGTGGGGAGACATTGGCTTTCAAGGTGATGATCCAAAAACAGATTTCCGTGGAATGGGCATGCTGGGATTGGCAAATTTACTGTATTTCAGTAAACATTACACAGAAGAAGCACGCCTCATCTTGTCCCACTCCAACCATCCAAGACTTGGATATTCTATGNCTATAGTTGGTATCAATCTGACAGAGATGGCTTATAGCTTACTAANAATGGGGGCCCTGAAGTCTCATTTCTATNACACTGTTCCTGATTTTCTCCAAATGAGAGGTTCCATCATTTTTATTGGTTCCTGGGGGTATGAAATATAAAAAATTTTTGGTTTTTAAAAGAAAACCTAAAAAACTTTTTTCCGGTTTACCCAAAATAAAAAAAAAAATTCCCT
Full Trace Sequence: TATTGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTTCCTTCATCTGGCACTACTTCTACAGCAACTACTTTCGGTTTTGGCTGAAATGGGTTCTCAGACAAATAAGTGGGAAATGTGAGTTGCAGAGAATTTGTGATGGAACTAAGGATGGAGCCAGCCGAACACACAGGATAGAATACTCATTGGAACATTCAAAATTTAAGGTACTGCGACATGCCATAAATATTCCAGAGGAGCAGGTGGACCGGTATGTAGCTGATATAGTAAAAGAAAAGAAGATCATTTTGGAAAAGGATAAAAGATTTGAGATAAATCTGAGGATTTGTTTGTTACAGATTTCTGGCTACAAGAAGCTCTATTTAGATGTGGAAAATTTAAGAAAGCAGTCTTATGACTCTGATAATAATTATCACGAACAGCAACTACTAGAGCTCTGGGACTTACTCATGCCTCATGAAAAGCTAAACAACAGAGTCACTAAACAGTGGGGAGACATTGGCTTTCAAGGTGATGATCCAAAAACAGATTTCCGTGGAATGGGCATGCTGGGATTGGCAAATTTACTGTATTTCAGTAAACATTACACAGAAGAAGCACGCCTCATCTTGTCCCACTCCAACCATCCAAGACTTGGATATTCTATGNCTATAGTTGGTATCAATCTGACAGAGATGGCTTATAGCTTACTAANAATGGGGGCCCTGAAGTCTCATTTCTATNACACTGTTCCTGATTTTCTCCAAATGAGAGGTTCCATCATTTTTATTGGTTCCTGGGGGTATGAAATATAAAAAATTTTTGGTTTTTAAAAGAAAACCTAAAAAACTTTTTTCCGGTTTACCCAAAATAAAAAAAAAAATTCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTTCCTTCATCTGGCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ830098
dbEST ID: 79647800
Trimmed Sequence: AAGAGTCAGAGCAACCCTTTCATTGGAAAGAAGGTGCTTGATTTGGTCATGGAATTTCTCTCTGTATTGGTTAAACTGCATAATGCTCTCAGGTTCTTCTTGAAACCAAAACTTGTCAAATTCATACACCAGGTAACAATACAACTGATGGAAACTCTTCATCTGAGGAAAATCAGGAACAGTGTTATAGAAATGAGACTTCAGGGCCCCATTCTTTAGTAAGCTATAAGCCATCTCTGTCAGATTGATACCAACTATAGCATAGGAATATCCAAGTCTTGGATGGTTGGAGTGGGACAAGATGAGGCGTGCTTCTTCTGTGTAATGTTTACTGAAATACAGTAAATTTGCCAATCCCAGCATGCCCATTCCACGGAAATCTGTTTTTGGATCATCACCTTGAAAGCCAATGTCTCCCCACTGTTTAGTGACTCTGTTGTTTAGCTTTTCATGAGGCATGAGTAAGTCCCAGAGCTCTAGTAGTTGCTGTTCGTGATAATTATTATCAGAGTCATAAGACTGCTTTCTTAAATTTTCCACATCTAAATAGAGCTTCTTGTAGCCAGAAATCTGTAACAAACAAATCCTCAGATTTATCTCAAATCTTTTATCTTTTCCCAAAATGATCTTTCTTTTCTTTTACTATATCAGCTACATACCGGTCCACCTGCTCCTCTGGAATATTTTATGGCATGTTCGCAGTACCTTTAAAATTTGGAAGTGTTTCCATTGAATTAATTTCTATCCCCGGTTGGGGTTCC
Full Trace Sequence: TGCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGTCAGAGCAACCCTTTCATTGGAAAGAAGGTGCTTGATTTGGTCATGGAATTTCTCTCTGTATTGGTTAAACTGCATAATGCTCTCAGGTTCTTCTTGAAACCAAAACTTGTCAAATTCATACACCAGGTAACAATACAACTGATGGAAACTCTTCATCTGAGGAAAATCAGGAACAGTGTTATAGAAATGAGACTTCAGGGCCCCATTCTTTAGTAAGCTATAAGCCATCTCTGTCAGATTGATACCAACTATAGCATAGGAATATCCAAGTCTTGGATGGTTGGAGTGGGACAAGATGAGGCGTGCTTCTTCTGTGTAATGTTTACTGAAATACAGTAAATTTGCCAATCCCAGCATGCCCATTCCACGGAAATCTGTTTTTGGATCATCACCTTGAAAGCCAATGTCTCCCCACTGTTTAGTGACTCTGTTGTTTAGCTTTTCATGAGGCATGAGTAAGTCCCAGAGCTCTAGTAGTTGCTGTTCGTGATAATTATTATCAGAGTCATAAGACTGCTTTCTTAAATTTTCCACATCTAAATAGAGCTTCTTGTAGCCAGAAATCTGTAACAAACAAATCCTCAGATTTATCTCAAATCTTTTATCTTTTCCCAAAATGATCTTTCTTTTCTTTTACTATATCAGCTACATACCGGTCCACCTGCTCCTCTGGAATATTTTATGGCATGTTCGCAGTACCTTTAAAATTTGGAAGTGTTTCCATTGAATTAATTTCTATCCCCGGTTGGGGTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGTCAGAGCAACCCTTTCA