ORFeome > elp6 ORF1 – XORFeome v1.0

elp6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: elp6
Gene ID: 5919932
Gene Page ID: 5919887
ORF Xenbase ID: 17274207

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123243
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ838263
dbEST ID: 79655965
Trimmed Sequence: ATGTTCCCCGAGCTCAACAGCCTGTTGGGAGTCACTACTGATACCCTGACACTGGGTAAATTTACTCTCCTCTGTGACTCTAATACAGACGGGAGCTTCCTGGTCCATCACTTCCTGTCCTACTACCTGAGAGCGGGGTGCCGGGTTTGCTTTGTGGCCCTTGTGCAGTCGTTCAGTCACTACAACATTGTGGCCCAGAAGCTGGGCGTTAACCTGAGTTCGGCTAAGGATGAGGGGCAGCTGGTGTTCCTGGAAGGACTAAAATCTTACACAGATTTGCTTTTTGGGGACAAGTCGGAGGCAGAAGAAACCAACCCACTCTGTTTCCTAAGGGCAGGATCAGACCTGAGACCTTTATACAGCTTTGTGAGTGCTGCGCTGGCTCCATCTGCTGGTCAGCCGTGGAAGTGTCCTGTGCTGATCCTGGATGATCTCAGTGTGCTGCTCAGTTTGGGGGTGACCTCTCTGCAGGTGCTGGACTTCATGCATTACTGTAGAGCCACTGTCTGCACTCAGTACAAGGGCAATGTCCTGTGCTTGGTGCATGGAGCGGAGGAGTCGGGGGATGAGGAGAATGAGTTAGTGCTGAGATCTCTGTCCCACCACACCCATCTGATTCTGCAAGCAAAAAGTTTGAACACGGGATTCTGTAAGGATGTGCATGGGCAGCTGAAAAATCAACAGAAAGGCCGTGTCCCGGGGGGAAACGGGGGAAAAACCCAACCCAAAAATCTATCCATAACAAAATCCAGGAAAAAAAGATGTGCCCGTTGGGTTTGGCGAGAAGTG
Full Trace Sequence: TCGCGGCACCAATAATGGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCCCCGAGCTCAACAGCCTGTTGGGAGTCACTACTGATACCCTGACACTGGGTAAATTTACTCTCCTCTGTGACTCTAATACAGACGGGAGCTTCCTGGTCCATCACTTCCTGTCCTACTACCTGAGAGCGGGGTGCCGGGTTTGCTTTGTGGCCCTTGTGCAGTCGTTCAGTCACTACAACATTGTGGCCCAGAAGCTGGGCGTTAACCTGAGTTCGGCTAAGGATGAGGGGCAGCTGGTGTTCCTGGAAGGACTAAAATCTTACACAGATTTGCTTTTTGGGGACAAGTCGGAGGCAGAAGAAACCAACCCACTCTGTTTCCTAAGGGCAGGATCAGACCTGAGACCTTTATACAGCTTTGTGAGTGCTGCGCTGGCTCCATCTGCTGGTCAGCCGTGGAAGTGTCCTGTGCTGATCCTGGATGATCTCAGTGTGCTGCTCAGTTTGGGGGTGACCTCTCTGCAGGTGCTGGACTTCATGCATTACTGTAGAGCCACTGTCTGCACTCAGTACAAGGGCAATGTCCTGTGCTTGGTGCATGGAGCGGAGGAGTCGGGGGATGAGGAGAATGAGTTAGTGCTGAGATCTCTGTCCCACCACACCCATCTGATTCTGCAAGCAAAAAGTTTGAACACGGGATTCTGTAAGGATGTGCATGGGCAGCTGAAAAATCAACAGAAAGGCCGTGTCCCGGGGGGAAACGGGGGAAAAACCCAACCCAAAAATCTATCCATAACAAAATCCAGGAAAAAAAGATGTGCCCGTTGGGTTTGGCGAGAAGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCCCGAGCTCAACAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838262
dbEST ID: 79655964
Trimmed Sequence: AAGCACAGCCGCAGACAGACCTCTGGCAAAGAACGCGACATGTTTGTCCTGGATCTTGTACTGATAGATTTCCGGCTGGTTTTTCCCCCGTTTCCCACTGGACACGGCCCCCCTGATGATCTTCAGCTGCCCATGCACATCCTTACAGAATCCCGTGCTCAAACCCTCTGCCTGCAGAATCAGATGGCTCTGGTGGGACAGAGATCTCAGCACTAACTCATTCTCCTCATCCCCCGACTCCTCCGCTCCATGCACCAAGCACAGGACATTGCCCTTGTACTGAGTGCAGACAGTGGCTCTACAGTAATGCATGAAGTCCAGCACCTGCAGAGAGGTCACCCCCAAACTGAGCAGCACACTGAGATCATCCAGGATCAGCACAGGACACTTCCACGGCTGACCAGCAGATGGAGCCGGCGCAGCACTCACAAAGCTGTATAAAGGTCTCAGGTCTGATCCTGCCCTTANGAAACAGAGTGGGTTGGTTTCTTCTGCCTCCGACTTGTCCCCCAAAAGCAAATCTGTGTAAGATTTTAGTCCTTCCAGGAACACCAGCTGCCCCTCATCCTAAGCCGAACTCCGGGTTAACGCCCACCTTCCGGGCCACAATGTTGTAATGACTGAACCATTGCCCCGGGGGCCCCAAGGCAAACCCCGGCACCCGCCCTTCTCAGGGTGTAAGGGAAAGGGAAAGGTATGGA
Full Trace Sequence: GGTATTCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGCACAGCCGCAGACAGACCTCTGGCAAAGAACGCGACATGTTTGTCCTGGATCTTGTACTGATAGATTTCCGGCTGGTTTTTCCCCCGTTTCCCACTGGACACGGCCCCCCTGATGATCTTCAGCTGCCCATGCACATCCTTACAGAATCCCGTGCTCAAACCCTCTGCCTGCAGAATCAGATGGCTCTGGTGGGACAGAGATCTCAGCACTAACTCATTCTCCTCATCCCCCGACTCCTCCGCTCCATGCACCAAGCACAGGACATTGCCCTTGTACTGAGTGCAGACAGTGGCTCTACAGTAATGCATGAAGTCCAGCACCTGCAGAGAGGTCACCCCCAAACTGAGCAGCACACTGAGATCATCCAGGATCAGCACAGGACACTTCCACGGCTGACCAGCAGATGGAGCCGGCGCAGCACTCACAAAGCTGTATAAAGGTCTCAGGTCTGATCCTGCCCTTANGAAACAGAGTGGGTTGGTTTCTTCTGCCTCCGACTTGTCCCCCAAAAGCAAATCTGTGTAAGATTTTAGTCCTTCCAGGAACACCAGCTGCCCCTCATCCTAAGCCGAACTCCGGGTTAACGCCCACCTTCCGGGCCACAATGTTGTAATGACTGAACCATTGCCCCGGGGGCCCCAAGGCAAACCCCGGCACCCGCCCTTCTCAGGGTGTAAGGGAAAGGGAAAGGTATGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCACAGCCGCAGACA