ORFeome > emc3 ORF1 – XORFeome v1.0

emc3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: emc3
Gene ID: 6077877
Gene Page ID: 942864
ORF Xenbase ID: 17274237

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081227
Original XGC clone length: 693

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ839665
dbEST ID: 79657367
Trimmed Sequence: ATGGCTGAGCCAGAGCTGTTGCTGGATTCCAACATTCGACTGTGGGTCGTTCTCCCCATCGTCTTCATCACGTTTTTCGTAGGAATGATCAGACATTACGTTTCCATTTTACTTCAGAGTGACAAAAAGCTAACACAGGAACAAGTGTCAGACAGCCAGGTGCTTATTCGTAGCAGAGTCCTTAGAGAGAATGGCAAATACATTCCAAAACAGTCATTCCTAATGAGGAAGTTCTTTTTCAATAATTCAGAAGATGGATTTTTCAAAAAGACCAAGAGGAAGGTGGTTCCCCCCTCCCCAATGACAGACCCTACAATGTTAACAGACATGATGAAAGGAAATGTGACCAATGTGCTTCCCATGATTCTCATTGGTGGATGGATCAACATGACTTTCTCCGGGTTTGTGACAACAAAAGTGCCATTTCCCTTGACTTTGCGTTTCAAACCAATGCTGCAGCAGGGAATAGAACTCCTGTCATTGGATGCCTCCTGGGTAAGTTCAGCTTCCTGGTATTTTCTGAATGTATTTGGGCTGAGAAGCATTTATTCACTGATTCTGGGACAGGATAATGCTGCAGATCAGTCGCGAGTGATGCAGGAACAGATGACTGGGGCAGCCATGGCAATGCCAGCAGACACCAACAAGGCTTTTTAGACGGAGTGGGAAGCTCTTGAGCTTAAAGATCACTTGGC
Full Trace Sequence: GGGGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGCCAGAGCTGTTGCTGGATTCCAACATTCGACTGTGGGTCGTTCTCCCCATCGTCTTCATCACGTTTTTCGTAGGAATGATCAGACATTACGTTTCCATTTTACTTCAGAGTGACAAAAAGCTAACACAGGAACAAGTGTCAGACAGCCAGGTGCTTATTCGTAGCAGAGTCCTTAGAGAGAATGGCAAATACATTCCAAAACAGTCATTCCTAATGAGGAAGTTCTTTTTCAATAATTCAGAAGATGGATTTTTCAAAAAGACCAAGAGGAAGGTGGTTCCCCCCTCCCCAATGACAGACCCTACAATGTTAACAGACATGATGAAAGGAAATGTGACCAATGTGCTTCCCATGATTCTCATTGGTGGATGGATCAACATGACTTTCTCCGGGTTTGTGACAACAAAAGTGCCATTTCCCTTGACTTTGCGTTTCAAACCAATGCTGCAGCAGGGAATAGAACTCCTGTCATTGGATGCCTCCTGGGTAAGTTCAGCTTCCTGGTATTTTCTGAATGTATTTGGGCTGAGAAGCATTTATTCACTGATTCTGGGACAGGATAATGCTGCAGATCAGTCGCGAGTGATGCAGGAACAGATGACTGGGGCAGCCATGGCAATGCCAGCAGACACCAACAAGGCTTTTTAGACGGAGTGGGAAGCTCTTGAGCTTAAAGATCACTTGGCCAACTTTCTTGGTACAAGTTGGCATTTATAGAAAGCATTGCTTAATCAATTGTTTCAACGAAAAGGTTACTTAACATTCCAAATAAAATTCTTTATTTTGCCACCCCCGCTTATTATCCCCCTTTAGTGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGCCAGAGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839664
dbEST ID: 79657366
Trimmed Sequence: GTGATCTGTAAGCTCAAGAGCTTCCCACTCCGTCTTAAAAGCCTTGTTGGTGTCTGCTGGCATTGCCATGGCTGCCCCAGTCATCTGTTCCTGCATCACTCGCGACTGATCTGCAGCATTATCCTGTCCCAGAATCAGTGAATAAATGCTTCTCAGCCCAAATACATTCAGAAAATACCAGGAAGCTGAACTTACCCAGGAGGCATCCAATGACAGGAGTTCTATTCCCTGCTGCAGCATTGGTTTGAAACGCAAAGTCAAGGGAAATGGCACTTTTGTTGTCACAAACCCGGAGAAAGTCATGTTGATCCATCCACCAATGAGAATCATGGGAAGCACATTGGTCACATTTCCTTTCATCATGTCTGTTAACATTGTAGGGTCTGTCATTGGNGGAGGGGGGAACCACCTTCCTCTTGGTCTTTTTGAAAAATCCATCTTCTGAATTATTGAAAAAGAACTTCCTCATTAGGAATGACTGTTTTGGAATGTATTTGCCATTCTCTCTAAGGACTCTGCTACGAAAAAGCACCTGGCTGTCTGACACTTGTTCCTGTGTTAGCTTTTTGTCACTCCGAAATAAAATGAAAACGTAATGTCTGATCATTTCCACCAAAAAACGTAAATAAGACAAATGGGAGAACGACCCCCAAGTCAAATGTTGGGAATCCCGCCACAGCTCTGCGCTCACCCCTGGTGGCCACTTTTTTGGGAACAAAATTTGGGCAGTATAGAGAAAGCAATTTGCAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGATCTGTAAGCTCAAGAGCTTCCCACTCCGTCTTAAAAGCCTTGTTGGTGTCTGCTGGCATTGCCATGGCTGCCCCAGTCATCTGTTCCTGCATCACTCGCGACTGATCTGCAGCATTATCCTGTCCCAGAATCAGTGAATAAATGCTTCTCAGCCCAAATACATTCAGAAAATACCAGGAAGCTGAACTTACCCAGGAGGCATCCAATGACAGGAGTTCTATTCCCTGCTGCAGCATTGGTTTGAAACGCAAAGTCAAGGGAAATGGCACTTTTGTTGTCACAAACCCGGAGAAAGTCATGTTGATCCATCCACCAATGAGAATCATGGGAAGCACATTGGTCACATTTCCTTTCATCATGTCTGTTAACATTGTAGGGTCTGTCATTGGNGGAGGGGGGAACCACCTTCCTCTTGGTCTTTTTGAAAAATCCATCTTCTGAATTATTGAAAAAGAACTTCCTCATTAGGAATGACTGTTTTGGAATGTATTTGCCATTCTCTCTAAGGACTCTGCTACGAAAAAGCACCTGGCTGTCTGACACTTGTTCCTGTGTTAGCTTTTTGTCACTCCGAAATAAAATGAAAACGTAATGTCTGATCATTTCCACCAAAAAACGTAAATAAGACAAATGGGAGAACGACCCCCAAGTCAAATGTTGGGAATCCCGCCACAGCTCTGCGCTCACCCCTGGTGGCCACTTTTTTGGGAACAAAATTTGGGCAGTATAGAGAAAGCAATTTGCAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGATCTGTAAGCTCAAGAGCTTC