ORFeome > emc8 ORF1 – XORFeome v1.0

emc8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: emc8
Gene ID: 6078576
Gene Page ID: 1003840
ORF Xenbase ID: 17274255

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084119
Original XGC clone length: 609

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ840069
dbEST ID: 79657771
Trimmed Sequence: ATGCCGGCATTTAAGTTAACAACACAAGCTTTCTGCAAAATGATGCTTCATAGCGCAAAATATCCATACTGTACTGTAAATGGCATTTTGGTGGCTCAGAAGCAAAAGCGTAAAGACGGTCATCAGCAAGTCCTGTTTGTGGACTGTATCCCACTTTTTCATGGCACTGTTGCTTTGGCACCTGTACTGGAAGTTGCATTAACACTGATCGATACCTGGTGCAAAGAGAATGACTATGTGATTGCTGGATATTATCAAGCAAATGAACGTCTAAGAGACACCGGTCCAAACCAAGTTGCTGAGAGAATAGCATCACGGATAGCAGAAGGCTTTAATGATGCTGCCCTAATAATGGTGGACAACGCCAAGTTCTCCATGGAATGCATAAGCCCTTCCTTTCATGTGTATGAGCACCATGATAACAGGTGGAAAAGCAGAGACCTGCATGAGGATTTTTTTGAAGATTGGCCAGAAGCTCAAAAGATTACAGCATCCCTCCTAGACAGCAGGTCATATGAGTCTCTTGTGGATTTTGATAGTCATCTTGATGATCTTCGGAATGACTGGGCCAACCCAGATATCAACAAGTCCATTCTTCATCTATGCTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGGCATTTAAGTTAACAACACAAGCTTTCTGCAAAATGATGCTTCATAGCGCAAAATATCCATACTGTACTGTAAATGGCATTTTGGTGGCTCAGAAGCAAAAGCGTAAAGACGGTCATCAGCAAGTCCTGTTTGTGGACTGTATCCCACTTTTTCATGGCACTGTTGCTTTGGCACCTGTACTGGAAGTTGCATTAACACTGATCGATACCTGGTGCAAAGAGAATGACTATGTGATTGCTGGATATTATCAAGCAAATGAACGTCTAAGAGACACCGGTCCAAACCAAGTTGCTGAGAGAATAGCATCACGGATAGCAGAAGGCTTTAATGATGCTGCCCTAATAATGGTGGACAACGCCAAGTTCTCCATGGAATGCATAAGCCCTTCCTTTCATGTGTATGAGCACCATGATAACAGGTGGAAAAGCAGAGACCTGCATGAGGATTTTTTTGAAGATTGGCCAGAAGCTCAAAAGATTACAGCATCCCTCCTAGACAGCAGGTCATATGAGTCTCTTGTGGATTTTGATAGTCATCTTGATGATCTTCGGAATGACTGGGCCAACCCAGATATCAACAAGTCCATTCTTCATCTATGCTTGCCAACTTTCTTGTACAAAAGTTGGCATTATAAAAAAAGCATTGCTTATCAATTTGTTGCAACAAACAGGTTACTATCAGTCCAAATAAAATCATTATTTGCCATCCAGCTAAATATCCCCCTATATGGATAAAAATAAAAAAGGAAAAAAAACTTATTTTCCCGGGCCACCTCCTGGCCCCGGGTCCAAAAAAAAATCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGCATTTAAGTTAACAACA

Sequences - 3ʹ (reverse) EST

Accession: JZ840068
dbEST ID: 79657770
Trimmed Sequence: GCATAGATGAAGAATGGACTTGTTGATATCTGGGTTGGCCCAGTCATTCCGAAGATCATCAAGATGACTATCAAAATCCACAAGAGACTCATATGACCTGCTGTCTAGGAGGGATGCTGTAATCTTTTGAGCTTCTGGCCAATCTTCAAAAAAATCCTCATGCAGGTCTCTGCTTTTCCACCTGTTATCATGGTGCTCATACACATGAAAGGAAGGGCTTATGCATTCCATGGAGAACTTGGCGTTGTCCACCATTATTAGGGCAGCATCATTAAAGCCTTCTGCTATCCGTGATGCTATTCTCTCAGCAACTTGGTTTGGACCGGTGTCTCTTAGACGTTCATTTGCTTGATAATATCCAGCAATCACATAGTCATTCTCTTTGCACCAGGTATCGATCAGTGTTAATGCAACTTCCAGTACAGGTGCCAAAGCAACAGTGCCATGAAAAAGTGGGATACAGTCCACAAACAGGACTTGCTGATGACCGTCTTTACGCTTTTGCTTCTGAGCCACCAAAATGCCATTTACAGTACAGTATGGATATTTTGCGCTATGAAGCACCATTTGCCGAGAGCTTGTGTTTGTTACTTAAATTGCCGCCTGG
Full Trace Sequence: GAAACTGCTATTGAACCATGTACAACGACTCACTACTAGGGGAAACCAGCCTGGGAGGGCAAAGAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATAGATGAAGAATGGACTTGTTGATATCTGGGTTGGCCCAGTCATTCCGAAGATCATCAAGATGACTATCAAAATCCACAAGAGACTCATATGACCTGCTGTCTAGGAGGGATGCTGTAATCTTTTGAGCTTCTGGCCAATCTTCAAAAAAATCCTCATGCAGGTCTCTGCTTTTCCACCTGTTATCATGGTGCTCATACACATGAAAGGAAGGGCTTATGCATTCCATGGAGAACTTGGCGTTGTCCACCATTATTAGGGCAGCATCATTAAAGCCTTCTGCTATCCGTGATGCTATTCTCTCAGCAACTTGGTTTGGACCGGTGTCTCTTAGACGTTCATTTGCTTGATAATATCCAGCAATCACATAGTCATTCTCTTTGCACCAGGTATCGATCAGTGTTAATGCAACTTCCAGTACAGGTGCCAAAGCAACAGTGCCATGAAAAAGTGGGATACAGTCCACAAACAGGACTTGCTGATGACCGTCTTTACGCTTTTGCTTCTGAGCCACCAAAATGCCATTTACAGTACAGTATGGATATTTTGCGCTATGAAGCACCATTTGCCGAGAGCTTGTGTTTGTTACTTAAATTGCCGCCTGGTGCCCACTTTTTTGTTACAAAGTTGCATTTTAAAAAAGCATTGCTTATCCATTTGGTTTCGACAAAACAGGGTTACATAATCAGAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATAGATGAAGAATGGACTTGTT