ORFeome > emid1 ORF2 – XORFeome v1.0

emid1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: emid1
Gene ID: 5872306
Gene Page ID: 5872274
ORF Xenbase ID: 17274273

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128667
Original XGC clone length: 1353

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ838783
dbEST ID: 79656485
Trimmed Sequence: ATGAAATTGTGGTTGCCCTGCTGCTCAGGTTGGCACATTCTGCTCTGCCTCTGTGCTTTTCTGGACAAAGGTATGTGCACATGGGCACCCAACACCCAGTACCGCTATTCACCCGTACTGCAACCGAAATCCAGGGAGTCACTCTCCACGCCTAGAAGGAATTGGTGTTCAGTGCCTGTGAGTCGGACAGTTTCATGCCAAGTTCAGAATGGCACCTTCATGCAGAGAGTGTATCAGAACTGCCACTGGGCATCAGGCTGCTCAGGAGGGAGTTATAGAACAGTTGCCAGACCGACATACAGACTCAGCTATAAGACAGTGACATTGCTGGAATGGAGATGCTGCCCAGGATACAGAGGAACAAACTGTGAGGAAGATACCATGGCCTTGGCAGAAGTACAGGAAGCTCCACGGATCAGTGCCCCAATTCGAAAATTGCCTCCCAGGGCTGGGAGCAGCTTTTCAGTTTGTCTAAACTGCAGCCCAATCCCTGAACTGAGCGAACGTTTGAGCTCTCTGGAATCCAAGGTAACAGTGATCTTGGAATCTGATCCTTCACTGTCCCAAAACTTAGCTCTCACAATACTGCATCTTCCATTGTTGGGGAACCCAAAACCCCCGGTTACCCCTGGAGAAGAATCGTCAAAGGGCATTGCTTTAAGGAAAAAATCGAAAGGACCAATTAGGTTTTTCCGGAAACCCAGGGAACCCGGAAAAAAAAAGGCCCAACTTGGGCGCCCAGGGTCCCCCCTAGGGCTCCCGGTTCGGCACATAAAAAGGAATGCCCACAATCTGGTTCCATCAGCGGTTAA
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATTGTGGTTGCCCTGCTGCTCAGGTTGGCACATTCTGCTCTGCCTCTGTGCTTTTCTGGACAAAGGTATGTGCACATGGGCACCCAACACCCAGTACCGCTATTCACCCGTACTGCAACCGAAATCCAGGGAGTCACTCTCCACGCCTAGAAGGAATTGGTGTTCAGTGCCTGTGAGTCGGACAGTTTCATGCCAAGTTCAGAATGGCACCTTCATGCAGAGAGTGTATCAGAACTGCCACTGGGCATCAGGCTGCTCAGGAGGGAGTTATAGAACAGTTGCCAGACCGACATACAGACTCAGCTATAAGACAGTGACATTGCTGGAATGGAGATGCTGCCCAGGATACAGAGGAACAAACTGTGAGGAAGATACCATGGCCTTGGCAGAAGTACAGGAAGCTCCACGGATCAGTGCCCCAATTCGAAAATTGCCTCCCAGGGCTGGGAGCAGCTTTTCAGTTTGTCTAAACTGCAGCCCAATCCCTGAACTGAGCGAACGTTTGAGCTCTCTGGAATCCAAGGTAACAGTGATCTTGGAATCTGATCCTTCACTGTCCCAAAACTTAGCTCTCACAATACTGCATCTTCCATTGTTGGGGAACCCAAAACCCCCGGTTACCCCTGGAGAAGAATCGTCAAAGGGCATTGCTTTAAGGAAAAAATCGAAAGGACCAATTAGGTTTTTCCGGAAACCCAGGGAACCCGGAAAAAAAAAGGCCCAACTTGGGCGCCCAGGGTCCCCCCTAGGGCTCCCGGTTCGGCACATAAAAAGGAATGCCCACAATCTGGTTCCATCAGCGGTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATTGTGGTTGCCCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838782
dbEST ID: 79656484
Trimmed Sequence: GAAACTTTCCTCCTCATCCTCATACTGTTCAGAGGGCATAAATCTGTAATGTGACGGCCCATTGCGCCTGCCCCGATAAAATCCAGGAGCACCAGAGGGGGTAGGTCCTGTTCCTGAACCAGCATCAGTCTCATGAATTCCAATCATTGTCTCCAATATTAAAACTCTCTCTGCTAAAATCTTCAGAGCCTCTCTGATTTGCAGCATCCTTTCCCCCGGCTCGCCTTTCTCTCCAGGTTCCCCTTTTTGTCCTGGGGTCCCAAGTTCCCCCTTTGTTCCTGGGTCACCTGCCATTCCAGACAGACCACTGTCTCCTTTCTCTCCTTTAGGGCCATTTTGACCCGGGGAACCAGGTAAACCATTTTGGCCTCTTAGTCCTGGGGGCCCAATTTGGCCTTGGGGTCCTGGTGGCCCAGCTGGTCCTGGAGGGCCCTTGGGTCCCTGAATACTGTGTCCTGATGTTTCCATAAATTTGTTTGACTGANACAAGTCCTGATCCATTAGCCTCTGTGTTGCAGTGGATGAAGGGCCAGCAGGGCCAGGGGGGCCTCTTTCACCAGTAGGACCGACTGCACCATCCTGTCCTGGTGGACCTGGAGCCCCACGGGGACCTGGGGGGCCGAGCTGGGCCTTTTATTTCTGGCATCCTTGACCTCCCTGGAACACCAACTGTTCCCTGCCGAGTTTTTCCCTAACTCAAAGCCCTTTTGCCAATTCCCTCCCCAGGGCTAACCCCGGGGCCTGCCGGGGTTTCCCAGACCAGGGGAAAAATTCAA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAACTTTCCTCCTCATCCTCATACTGTTCAGAGGGCATAAATCTGTAATGTGACGGCCCATTGCGCCTGCCCCGATAAAATCCAGGAGCACCAGAGGGGGTAGGTCCTGTTCCTGAACCAGCATCAGTCTCATGAATTCCAATCATTGTCTCCAATATTAAAACTCTCTCTGCTAAAATCTTCAGAGCCTCTCTGATTTGCAGCATCCTTTCCCCCGGCTCGCCTTTCTCTCCAGGTTCCCCTTTTTGTCCTGGGGTCCCAAGTTCCCCCTTTGTTCCTGGGTCACCTGCCATTCCAGACAGACCACTGTCTCCTTTCTCTCCTTTAGGGCCATTTTGACCCGGGGAACCAGGTAAACCATTTTGGCCTCTTAGTCCTGGGGGCCCAATTTGGCCTTGGGGTCCTGGTGGCCCAGCTGGTCCTGGAGGGCCCTTGGGTCCCTGAATACTGTGTCCTGATGTTTCCATAAATTTGTTTGACTGANACAAGTCCTGATCCATTAGCCTCTGTGTTGCAGTGGATGAAGGGCCAGCAGGGCCAGGGGGGCCTCTTTCACCAGTAGGACCGACTGCACCATCCTGTCCTGGTGGACCTGGAGCCCCACGGGGACCTGGGGGGCCGAGCTGGGCCTTTTATTTCTGGCATCCTTGACCTCCCTGGAACACCAACTGTTCCCTGCCGAGTTTTTCCCTAACTCAAAGCCCTTTTGCCAATTCCCTCCCCAGGGCTAACCCCGGGGCCTGCCGGGGTTTCCCAGACCAGGGGAAAAATTCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAACTTTCCTCCTCATCCT