ORFeome > eno1 ORF1 – XORFeome v1.0

eno1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: eno1
Gene ID: 6256554
Gene Page ID: 483499
ORF Xenbase ID: 17274363

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054169
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID: 2023
Ensembl gene IDs: ENSG00000074800
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,266200,312170,313400,600858

Library Location

Plate ID: GDExl11001
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ839144
dbEST ID: 79656846
Trimmed Sequence: ATGTCTATCAAGAACATCCGAGCACGTGAAATATTTGATTCTCGTGGGAACCCTACAGTGGAGGTTGACCTATACACTTGCAAAGGACTGTTCCGTGCTGCTGTTCCAAGTGGAGCTTCCACTGGTATTTATGAAGCACTAGAACTCCGGGACAATGACAAGACTCGCTACCTGGGAAAGGGTGTGTCTAAAGCAGTTGAGCACATCAATAAAACCATTGCACCTGCATTGGTAGGCAAGAATCTAAATGTTGTTGAGCAGGAAAAGTTTGACAAGCTCATGATTGAAATGGATGGAACTGAAAACAAATCCAAATTTGGTGCTAATGCACTCCTGGGAGTGTCCCTGGCAGTGTGTAAAGCTGGAGCTGCAGAGAAGGGAGTCCCACTGTACCGTCACATTGCTGACCTGGCTGGGAACCCTGAGGTCATACTTCCTGTACCGGCATTTAATGTTATCAATGGTGGCTCTCATGCTGGCAACAAGCTGGCTATGCAAGAATTCATGATCTTGCCTGTGGGTGCAGACAGCTTTAAGGAGGCCATGCGCATAGGGGCAGAGGTGTATCACAATCTGAAGAATGTCATCAAGGAGAAATATGGAAAGGATGCCACAGATGTTGGTGATGGAAGGGGGTTTCGCTCCCAATATCTTGGAAGAACAAGAAAGCCTTGGAACTTCTGGAAACTGGCATTTACAAGGCAGGAATACCCAATAAGAATGTCCTTTGGGATGGAACGTGGCGGCATCGGAAATTCCAACCGGGATGGAAAAAATTTAAATCGGGAAACTTCAAGTTCCCCCCCAAG
Full Trace Sequence: GGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTATCAAGAACATCCGAGCACGTGAAATATTTGATTCTCGTGGGAACCCTACAGTGGAGGTTGACCTATACACTTGCAAAGGACTGTTCCGTGCTGCTGTTCCAAGTGGAGCTTCCACTGGTATTTATGAAGCACTAGAACTCCGGGACAATGACAAGACTCGCTACCTGGGAAAGGGTGTGTCTAAAGCAGTTGAGCACATCAATAAAACCATTGCACCTGCATTGGTAGGCAAGAATCTAAATGTTGTTGAGCAGGAAAAGTTTGACAAGCTCATGATTGAAATGGATGGAACTGAAAACAAATCCAAATTTGGTGCTAATGCACTCCTGGGAGTGTCCCTGGCAGTGTGTAAAGCTGGAGCTGCAGAGAAGGGAGTCCCACTGTACCGTCACATTGCTGACCTGGCTGGGAACCCTGAGGTCATACTTCCTGTACCGGCATTTAATGTTATCAATGGTGGCTCTCATGCTGGCAACAAGCTGGCTATGCAAGAATTCATGATCTTGCCTGTGGGTGCAGACAGCTTTAAGGAGGCCATGCGCATAGGGGCAGAGGTGTATCACAATCTGAAGAATGTCATCAAGGAGAAATATGGAAAGGATGCCACAGATGTTGGTGATGGAAGGGGGTTTCGCTCCCAATATCTTGGAAGAACAAGAAAGCCTTGGAACTTCTGGAAACTGGCATTTACAAGGCAGGAATACCCAATAAGAATGTCCTTTGGGATGGAACGTGGCGGCATCGGAAATTCCAACCGGGATGGAAAAAATTTAAATCGGGAAACTTCAAGTTCCCCCCCAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTATCAAGAACATCCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839143
dbEST ID: 79656845
Trimmed Sequence: GTTGAAAACTGGTTTTCTGAAGTTTTTTCCAGCAAAGCGGGCCTTGCTGCCAAGTTCTTCTTCAATCCTGAGCAATTGGTTGTACTTTGCAAGTCGCTCAGATCTGCATGGAGCCCCAGTCTTTATCTGTCCAGTGCAAAGACCAACCACTAAGTCAGCAATGAAAGTATCTTCTGTCTCCCCAGAACGATGGCTGACCATCACACCCCAGCCATTTGACTGAGCCAGCTTGCACGCCTCCAGGGATTCTGTCACTGTGCCAATCTGATTGACTTTCAGAAGCAGACAGTTACAAGCCTTCTCCTCCACAGCCTTGGCAATACGCTTAGGGTTGGTCACAGTCAAGTCATCACCAACTACCTGGATACCAGAAGCTGCTGTGAACTTTGTCCAGGCTTCCCAATGATCCTGGTCAAAGGGATCTTCAATGGATACCACTGGATAATTTTTGACAAAGCTCATGTACAGTTCAGCCAGCTTGTCAGGTGAGATGTATCTGCTGGGGTCATCGGGGGACTTGAAGTCCAGATCATATTTTCCATCACGGTAGAATTCAGATGCTGCCACGTCCATCCCAATGACAATCTTATCTGGGTAATCTGCCTTTGGTAATGGCAGTTTTCAGAGGCTCCCAGGCCTTCTTTTGTCCCCAAAGATATTGGGGAAGCGAAACCCCCCTTCATCACCAAACATTTGGGGGCATCCCTTTTCCATATTTCTCCCTTGAATGAAATTTCTTTTAGAAATTGTGAAAAACCCCTCTCTCCCCCC
Full Trace Sequence: GCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGAAAACTGGTTTTCTGAAGTTTTTTCCAGCAAAGCGGGCCTTGCTGCCAAGTTCTTCTTCAATCCTGAGCAATTGGTTGTACTTTGCAAGTCGCTCAGATCTGCATGGAGCCCCAGTCTTTATCTGTCCAGTGCAAAGACCAACCACTAAGTCAGCAATGAAAGTATCTTCTGTCTCCCCAGAACGATGGCTGACCATCACACCCCAGCCATTTGACTGAGCCAGCTTGCACGCCTCCAGGGATTCTGTCACTGTGCCAATCTGATTGACTTTCAGAAGCAGACAGTTACAAGCCTTCTCCTCCACAGCCTTGGCAATACGCTTAGGGTTGGTCACAGTCAAGTCATCACCAACTACCTGGATACCAGAAGCTGCTGTGAACTTTGTCCAGGCTTCCCAATGATCCTGGTCAAAGGGATCTTCAATGGATACCACTGGATAATTTTTGACAAAGCTCATGTACAGTTCAGCCAGCTTGTCAGGTGAGATGTATCTGCTGGGGTCATCGGGGGACTTGAAGTCCAGATCATATTTTCCATCACGGTAGAATTCAGATGCTGCCACGTCCATCCCAATGACAATCTTATCTGGGTAATCTGCCTTTGGTAATGGCAGTTTTCAGAGGCTCCCAGGCCTTCTTTTGTCCCCAAAGATATTGGGGAAGCGAAACCCCCCTTCATCACCAAACATTTGGGGGCATCCCTTTTCCATATTTCTCCCTTGAATGAAATTTCTTTTAGAAATTGTGAAAAACCCCTCTCTCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGAAAACTGGTTTTCTGAAGTT