ORFeome > enpp2 ORF2 – XORFeome v1.0

enpp2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: enpp2
Gene ID: 1016191
Gene Page ID: 1016185
ORF Xenbase ID: 17274399

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110924
Original XGC clone length: 2625

Human orthology & disease relationships

NCBI Entrez ID: 5168
Ensembl gene IDs: ENSG00000136960
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,108500,124200,125853,170400,200950,208000,232600,240600,241500,241510,261750,266120,272300,300559,601003,601382,601887,602475,603041,609560,609909

Library Location

Plate ID: GDExl11085
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ837688
dbEST ID: 79655390
Trimmed Sequence: ATGGCAATGAAAAACGGATTCAATGTTGTTAGTGGGCCGATCTTCGACTATGACTACGACGGCATATATGATACTATGGACAAAATAAAAACGTTTGTGGATGGGTCCATTCCAGTCCCGACTCATTACTACTACGTTCTAACCAACTGCATGGATTTTAACCAATCGGTTGACAACTGTGACGGGCGATTATCAGTTGTTTCCTTTGTCATTCCGCACCGACCTGATAATGATGAAAGCTGCAATAGTTCACAGGAGGAGTCCAAATGGGTAGAAGACCTCCTGAAGATGCACACCGCACGCATCCGGGACATTGAGCTTCTCACAAGCCTGGACTTCTATAGAAAGACCAACCGCAGCTACATAGAAATCCTTTCTCTAAAGACACATCTGCATACGTACGAGAGTGAGATTTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAATGAAAAACGGATTCAATGTTGTTAGTGGGCCGATCTTCGACTATGACTACGACGGCATATATGATACTATGGACAAAATAAAAACGTTTGTGGATGGGTCCATTCCAGTCCCGACTCATTACTACTACGTTCTAACCAACTGCATGGATTTTAACCAATCGGTTGACAACTGTGACGGGCGATTATCAGTTGTTTCCTTTGTCATTCCGCACCGACCTGATAATGATGAAAGCTGCAATAGTTCACAGGAGGAGTCCAAATGGGTAGAAGACCTCCTGAAGATGCACACCGCACGCATCCGGGACATTGAGCTTCTCACAAGCCTGGACTTCTATAGAAAGACCAACCGCAGCTACATAGAAATCCTTTCTCTAAAGACACATCTGCATACGTACGAGAGTGAGATTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGAAAAAAAACATGTCTCAAATCTTTAAATGTTACAAAAAATGCCGGGGGGAAAAAGACCAGGTTCCCTTTCTCCAAGGGTAAAAAATAGTTTCCCAAAAAAAAAAAAATAAAGGGTGCCTCCTCAAAAAAACAAACAAAAAAATAAAATATATCATTGAGTGGACGCTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAATGAAAAACGGATTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837687
dbEST ID: 79655389
Trimmed Sequence: AATCTCACTCTCGTACGTATGCAGATGTGTCTTTAGAGAAAGGATTTCTATGTAGCTGCGGTTGGTCTTTCTATAGAAGTCCAGGCCTGTGAGAAGCTCAATGTCCCGGATGCGTGCGGTGTGCATCTTCAGGAGGTCTTCTACCCATTTGGACTCCTCCTCTGAACTATTGCAGCTTTCATCATTATCAGGTCGGTGCGGAATGACAAAGGAAACAACTGATAATCGCCCGTCACACTTGTCAACCGCTTGGTTAAAATCCATGCAACTGGTTAGAACGTAGTAGTAATGAGTCGGGACTGGAATGGACCCATCCACAAACGTTTTTATTTTGTCCATAGTATCATATACGCCGTCGTAGTCATAGTCGAAGATCGGCCCACTAACAACATTGAATCCGTTTTTCATTGCCATGGG
Full Trace Sequence: GGGGCGGGGAACAGCCACTGAACAAGGACAAACGAATCACTAAAAGGGGAGAACAGCCCGGAGGGCAAAAAAGGAGATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCTCACTCTCGTACGTATGCAGATGTGTCTTTAGAGAAAGGATTTCTATGTAGCTGCGGTTGGTCTTTCTATAGAAGTCCAGGCCTGTGAGAAGCTCAATGTCCCGGATGCGTGCGGTGTGCATCTTCAGGAGGTCTTCTACCCATTTGGACTCCTCCTCTGAACTATTGCAGCTTTCATCATTATCAGGTCGGTGCGGAATGACAAAGGAAACAACTGATAATCGCCCGTCACACTTGTCAACCGCTTGGTTAAAATCCATGCAACTGGTTAGAACGTAGTAGTAATGAGTCGGGACTGGAATGGACCCATCCACAAACGTTTTTATTTTGTCCATAGTATCATATACGCCGTCGTAGTCATAGTCGAAGATCGGCCCACTAACAACATTGAATCCGTTTTTCATTGCCATGGGTGCCAACTTTTTTGTACAAAGTTGGCAGTATAAAAAAGCATTGGTCAGCAGTTTGTTGCAACGAACAGGTCACTATCAGTCAGAATAAGATCATTATTTGGGGCCCGAGGCTGAAAAAAAAAAAAGAGTAACAACGTCGGACGGGGGGGGGGAGGGAGCGGGAAAAAAAAGGGCAAAGGGCCGTGGGGGGAGGGGGGGAAAAGAAAAAAACGGGGGTGAGGGGAGGGGGGGCGGCGGGAAGGGGAAGGGAAAAAAAAAAGAGAAAAAGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGAGGGGGGGGGGGGGGGGGGGGGGCGGAGGGGGGGGGAGGGGCGAAGGAGGGGGAGGGGGGGGGGGGGAAGGGGGGGGGGGAGGGGAGGGGGGAAGGGGGGGGGGGGGGGAGGGGAGGAAGGGGGGAANGGGGAGGGGCGCGGGGGGGGGGGGGGAGGGGGCGGGAGGGGGGAGGGAGTNGAGGGGCGGGNAGGGAGGGGAGGAGAAGGGAGGGAGGGGGAGAAGTGGGGGAGAGAGNCGGAGGGNGAAGGGGCGGAGGAGGAAGGAGAGCGGGAGGNGGTGGGTGGAGGAGGCNCAGGGGGGGNGGNAGGGAGCGGGGNAGGNANNNGGNCGGGGGTCGGGGAGAGGAGGGGGAGGGGAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCTCACTCTCGTACGTATG