ORFeome > ensa ORF1 – XORFeome v1.0

ensa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ensa
Gene ID: 6077899
Gene Page ID: 943823
ORF Xenbase ID: 17274417

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044986
Original XGC clone length: 378

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ823883
dbEST ID: 79641585
Trimmed Sequence: ATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTT
Full Trace Sequence: CAATAATGGATTTCATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATAAAAATAAAATAAAACAGTTNNCGGGGGGCCTGAGATCGCCCCTCTTCTTCCCCGGTTCTCGGAGCCCGGCCAAAAGAAAATATCGGTGGGCATCCTGGCGCAGCTTTTCTCCCCGATATGCAACCCCCCGGTAAGTTTCACGGGAAACTTTTTTTTGACGCAGAAGTTGCAGCGGGCCAGGGGGGATCTCCATTCCGTTCGCCGGGGGCTGGTCAGTAAAATTCCCTTTTGTACATTCCACAACAAAACCGAAATAAGGGCCTCTTCTCTTTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGATAAGTACATAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829192
dbEST ID: 79646894
Trimmed Sequence: CACGTGGTGCAAGTCCTCGACATGCCCCGCTAGCTTGCTGGTCACCAGTGAAGACTTCCTCTGCGGAAGGTCCTGTGGCGTAGGGATGTGGTCTCCGGTTACCAAGTTCTTGTCTGGCCCTGCGCATGGCAGCTGTTTGTTCTTTATCTTGGCCTTTGCCATGTTGTAGTCACCCGAGTCAAAGTACTTTTGTCCTTTTTGAAGCCTTTTCATCAGGAAATCTGAACCTCCAGGTTTTTGTCCTAAATTAGGGTATTTGGCTTTCAATTTCTGCTCCTCTGCTTTTTCAGGAGTCACCGCTTCCTTTTCTTGTGAGTCCTGCTTTTCCTCGCCGGTCTCTTCCAGGTGCGAGTCTCCTATGTACTTATCGGACATGG
Full Trace Sequence: TGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGTGGTGCAAGTCCTCGACATGCCCCGCTAGCTTGCTGGTCACCAGTGAAGACTTCCTCTGCGGAAGGTCCTGTGGCGTAGGGATGTGGTCTCCGGTTACCAAGTTCTTGTCTGGCCCTGCGCATGGCAGCTGTTTGTTCTTTATCTTGGCCTTTGCCATGTTGTAGTCACCCGAGTCAAAGTACTTTTGTCCTTTTTGAAGCCTTTTCATCAGGAAATCTGAACCTCCAGGTTTTTGTCCTAAATTAGGGTATTTGGCTTTCAATTTCTGCTCCTCTGCTTTTTCAGGAGTCACCGCTTCCTTTTCTTGTGAGTCCTGCTTTTCCTCGCCGGTCTCTTCCAGGTGCGAGTCTCCTATGTACTTATCGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTCGGGGCCCGAGCAAAAAAATGAACGTCGTGTTAATACGCGTGGACTGGGGAAGTGGCAGGGGACTTGGAGCGCTGGGGGGGGGTTGCGGGTGGGGGGGAAGAGGGTGGGGGGTGGATGGTGAAGGATGGGAGGGGGGGGGAAGTGGGGGGAAGTGGAGAGGGGTGAGGGTGGAGGAGGCGGGTGGACGGGGGAGGGAGTGGAGGGGTTGGAGGGAGGAAGGAGGGAGGAACGGAGAGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGTGGTGCAAGTCCTC