ORFeome > eomes ORF1 – XORFeome v1.0

eomes ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: eomes
Gene ID: 865305
Gene Page ID: 479768
ORF Xenbase ID: 17274441

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125986
Original XGC clone length: 2001

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ838055
dbEST ID: 79655757
Trimmed Sequence: ATGCAGCTGGGAGAGCAGCTACTGAACAGCTCCACTCCTAACCTGCCCCACACCTTCTACCCTCTGACAGGCGACCCCAGCAGTGCTGTCCATAGTCCCAGCTTGGAGTTTAGTGTGGGGCACAAGGGCCAACAGCACAAGAAATACAGCAGCGGCAGCAGCAGGGGGCTCCAGTTAGACAGTCCCAGAGAAGCTGGTTCCAGCAGCACAATGCTCAGCGAAACTGGAGAAGGTTTCTCGGTAGCCAAAACGTTACCGGACAACGTGCGCAAAGGCTCCCCATCCGCAGAGGAGGAACTGAACACCGCGGTACCAACTTCAGCTCCTCGCTACCTGGACGGCAGCCTACAGGCGGCATCTGAGCGCTACTACCTACAGCCCCAGGGCCAACAGTTGCAGCAAACTACCACAGAGCTCGGCTCCCCATGTTCCATCTTCCCTTATGCGCCTCCACAGCACAGCGCCGTGTATCCTGCAGGAGGCGCCGCCAGGTACCCACCATACGGCAGCATGTTGCCCCCAGCCGGCTTCTCCCCTCCTGTGTGCCCATCCCGGCCTCAGTACTCCTCAGGCTACCAGTACAGCCAGGCCCCAGGGACCATGTATAGCCCATACCCACCCGCAGGTACTGGCAGTGGACTCAGTGCGCTTGGGCTGCCAGGCCGCCGGTCCGGGAGTTCGTGCCCAGGTCTTCCTCTGTACCGGCCCCCTCCTGGCTAAATTTCAACCGCCCCCAAACTTAAAATATAATACCAAACAAGGGGAAAGAAAGATGTTTTCCTTTCCCTCATTTTCAACACCC
Full Trace Sequence: GGATGTTTTATTTTTAGACTGGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGGGAGAGCAGCTACTGAACAGCTCCACTCCTAACCTGCCCCACACCTTCTACCCTCTGACAGGCGACCCCAGCAGTGCTGTCCATAGTCCCAGCTTGGAGTTTAGTGTGGGGCACAAGGGCCAACAGCACAAGAAATACAGCAGCGGCAGCAGCAGGGGGCTCCAGTTAGACAGTCCCAGAGAAGCTGGTTCCAGCAGCACAATGCTCAGCGAAACTGGAGAAGGTTTCTCGGTAGCCAAAACGTTACCGGACAACGTGCGCAAAGGCTCCCCATCCGCAGAGGAGGAACTGAACACCGCGGTACCAACTTCAGCTCCTCGCTACCTGGACGGCAGCCTACAGGCGGCATCTGAGCGCTACTACCTACAGCCCCAGGGCCAACAGTTGCAGCAAACTACCACAGAGCTCGGCTCCCCATGTTCCATCTTCCCTTATGCGCCTCCACAGCACAGCGCCGTGTATCCTGCAGGAGGCGCCGCCAGGTACCCACCATACGGCAGCATGTTGCCCCCAGCCGGCTTCTCCCCTCCTGTGTGCCCATCCCGGCCTCAGTACTCCTCAGGCTACCAGTACAGCCAGGCCCCAGGGACCATGTATAGCCCATACCCACCCGCAGGTACTGGCAGTGGACTCAGTGCGCTTGGGCTGCCAGGCCGCCGGTCCGGGAGTTCGTGCCCAGGTCTTCCTCTGTACCGGCCCCCTCCTGGCTAAATTTCAACCGCCCCCAAACTTAAAATATAATACCAAACAAGGGGAAAGAAAGATGTTTTCCTTTCCCTCATTTTCAACACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGGGAGAGCAGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838054
dbEST ID: 79655756
Trimmed Sequence: AGAACTAGAGTAGAAAGAGTAATACCCAAGTCCCTTAGTGGCATCTTTATAGTCCTCAGTGCCAATGTCTTCACATTTTATAGGAGGGGAGTTTTCATTGCTTGAGGTGCTAGGGGAGAGCCTCCTTCTCTTACATGCACCCGTATACACCCCTGAATCATTAGAGTCTAGTGATTTAATGGAGGGAGGGGTTTCTACCCAGGAAGAGCTCATCTCTTCCTTGACCTTGTCCTTAGGTAGGAGATCTTCTGAGAAACCTGAAGGACTTGACCTTGAGGACCAAGGTAAACTTGTTGTCATTTTCCTCTGATAGGTAGAACCTCTGCTTCCCCAGCCTGCCATGGAGGCAAAGGCTGCATCTGGGTAGTAGGCCATTGGGTGGGAGGTTTGGATGGGCAGAGACTTAATGCCATAGGTGAGGAGGGAACCTGAGGAGTAGTCTGTTTCGTAGGCCCCCATGTCCAGTTTATTTGCAGCAGCTTGTTGCACGGGGGTCACAAACCACCTCTGTGGAGGAACATTTGCCACTTCTTCATTAGTCTGTGGGGACAGGAGACCATTTGCTTTGGGGACAGTCCTCTCCCCACTGTAGTATCTGGCAGGGGGCAAGGTGTTGACGAACTGGTTCCTGGAGAAAGGCTTCACACTGTATCGGGTCCCCGGGAACTATCTTGGTGACATCTAGGAAAATCCACCAGGAAATTGGCGTTAATCTGTCACTTTTCT
Full Trace Sequence: GGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAACTAGAGTAGAAAGAGTAATACCCAAGTCCCTTAGTGGCATCTTTATAGTCCTCAGTGCCAATGTCTTCACATTTTATAGGAGGGGAGTTTTCATTGCTTGAGGTGCTAGGGGAGAGCCTCCTTCTCTTACATGCACCCGTATACACCCCTGAATCATTAGAGTCTAGTGATTTAATGGAGGGAGGGGTTTCTACCCAGGAAGAGCTCATCTCTTCCTTGACCTTGTCCTTAGGTAGGAGATCTTCTGAGAAACCTGAAGGACTTGACCTTGAGGACCAAGGTAAACTTGTTGTCATTTTCCTCTGATAGGTAGAACCTCTGCTTCCCCAGCCTGCCATGGAGGCAAAGGCTGCATCTGGGTAGTAGGCCATTGGGTGGGAGGTTTGGATGGGCAGAGACTTAATGCCATAGGTGAGGAGGGAACCTGAGGAGTAGTCTGTTTCGTAGGCCCCCATGTCCAGTTTATTTGCAGCAGCTTGTTGCACGGGGGTCACAAACCACCTCTGTGGAGGAACATTTGCCACTTCTTCATTAGTCTGTGGGGACAGGAGACCATTTGCTTTGGGGACAGTCCTCTCCCCACTGTAGTATCTGGCAGGGGGCAAGGTGTTGACGAACTGGTTCCTGGAGAAAGGCTTCACACTGTATCGGGTCCCCGGGAACTATCTTGGTGACATCTAGGAAAATCCACCAGGAAATTGGCGTTAATCTGTCACTTTTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAACTAGAGTAGAAAGAGTAA