ORFeome > epha4 ORF1 – XORFeome v1.0

epha4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: epha4
Gene ID: 1015806
Gene Page ID: 1015802
ORF Xenbase ID: 17274507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043626
Original XGC clone length: 2961

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ823960
dbEST ID: 79641662
Trimmed Sequence: ATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTCTTTGGTGGAAGTTCGAGGCTCTTGTGTAGACAACTCAGAAGAAAAAGATGTTGCTAAGATGTACTGTGGTGCTGATGGAAGAGTGGCTGGCGGCCCATTTGGAAA
Full Trace Sequence: ATGGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTCTTTGGTGGAAGTTCGAGGCTCTTGTGTAGACAACTCAGAAGAAAAAGATGTTGCTAAGATGTACTGTGGTGCTGATGGAAGAGTGGCTGGCGGCCCATTTGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGATTGTACATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829269
dbEST ID: 79646971
Trimmed Sequence: AACAGGAACCATCCTGCCTTGCATTTGCTGCAACTGGGTCCTCATTCCTTGGACGCTGCTCAGGATCTTGTTCTGGTGTGAAGGGGAACTAATGCCAATCCTGGTCAAGTCATCTTGATTCACATGCACGACTGCTTCCAAGCTGGTGTATCCGGCTGCTGTGAAGTTATCTTTGTATCTTTCCATTTTGATGGCCTGCAGCCAATCAAGCACAGAAGCCACCTGGGACCATTCAGGCGAACTGGGGTCCAGCAGAGCCGTATTTGTTCTGCTTGAATTCTCCAGCCCAGTCCTTTTCAAACTGTTTGGGTTCCTGATGAGTTTATCCAGCATGCTGACTATCTGCCCAAATTTTGGTCGGTCACTACGATCCTTCTGCCAGCAGTCCAACATGAGCTGATGCAGTGCAATAGGGCAGTCCATAGGCGGGGGCAGCCTGTATCCTTCCTCGATTGCTTTAATTACATCTTGATTGGACATATCCCAGTAAGGCCTCTCTCCATAAGACATGACTTCCCACATGACAATGCCATAGCTCCAGACATCACTAGCAGAAGTGAATTTCCTGTATGCAATAGCTTCTGGTGCAGTCCATCGGATTGGGATCTTGCCACCCCTGGTTGTGTAGGCTGCTTCAGGGTCATCTTCCAGCACCCGAGACATGCCAAAATCAAAGACCTTTACAAACCAGGTTTGCTGGTTCACAAGGAATATTAACCAACCACTTAGGGTCCCCGGGGCCCCATAAACTCATGGT
Full Trace Sequence: TGGCAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACAGGAACCATCCTGCCTTGCATTTGCTGCAACTGGGTCCTCATTCCTTGGACGCTGCTCAGGATCTTGTTCTGGTGTGAAGGGGAACTAATGCCAATCCTGGTCAAGTCATCTTGATTCACATGCACGACTGCTTCCAAGCTGGTGTATCCGGCTGCTGTGAAGTTATCTTTGTATCTTTCCATTTTGATGGCCTGCAGCCAATCAAGCACAGAAGCCACCTGGGACCATTCAGGCGAACTGGGGTCCAGCAGAGCCGTATTTGTTCTGCTTGAATTCTCCAGCCCAGTCCTTTTCAAACTGTTTGGGTTCCTGATGAGTTTATCCAGCATGCTGACTATCTGCCCAAATTTTGGTCGGTCACTACGATCCTTCTGCCAGCAGTCCAACATGAGCTGATGCAGTGCAATAGGGCAGTCCATAGGCGGGGGCAGCCTGTATCCTTCCTCGATTGCTTTAATTACATCTTGATTGGACATATCCCAGTAAGGCCTCTCTCCATAAGACATGACTTCCCACATGACAATGCCATAGCTCCAGACATCACTAGCAGAAGTGAATTTCCTGTATGCAATAGCTTCTGGTGCAGTCCATCGGATTGGGATCTTGCCACCCCTGGTTGTGTAGGCTGCTTCAGGGTCATCTTCCAGCACCCGAGACATGCCAAAATCAAAGACCTTTACAAACCAGGTTTGCTGGTTCACAAGGAATATTAACCAACCACTTAGGGTCCCCGGGGCCCCATAAACTCATGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACAGGAACCATCCTGCCTT