ORFeome > epyc ORF1 – XORFeome v1.0

epyc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: epyc
Gene ID: 954689
Gene Page ID: 954683
ORF Xenbase ID: 17274573

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078578
Original XGC clone length: 957

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839999
dbEST ID: 79657701
Trimmed Sequence: ATGAAGACTTTTGTAAATCTGTTTCTGGGACTTTTTATACTTCAAACAGCCTTAGCTGCTCCCACAATTGAGACCATAAACTATGACACGGATACATATGAGGATGTACTGGATAGTCTTTATGACTATGACGAAAATCCTATTGTTGATCAAGGAAAGATAGAGATTGGGACTGTATTACCAGTTGTGAACAGGCCGATCCTTTCACCAGAACAGGTTCCAGAAGAAACAGAAGAGGCAGAAGAATCAACTCCAAAATTAATTGATGGTTCTTCACCACAGGGACCCTTGACTCCTGGAGTCCAAGGTCCAGACACAAGTGGAGCCATTTCACCAACGTGTATTCTGTGTGCTTGCCTCATTACAACCGTTTACTGCGATGACCACAATCTTGATACCATCCCTCCTCTTCCCAAAGAAACCACTCATGTCTACTTGCGTTTCAACAGAATTAGCAAAATAAGCAAACATGACTTTAATCATCTAACTAAATTAAAGAAGATTGACTTGACGTCGAACATCATATCTGAGATCGATGAAGATGCCTTTAGGAATCTGCCTCAACTGTCTGAACTCATACTCCGAGATAATAACATAAGGCAACTTCCAGAGCTTCCCAATACCATGAACTTCATTGATGTCAGCAACAACAGACTTGGTTCTAAAGGAATAAAGAAAGAGGCATTCAAGGACATGACAAATCTTCACATTTTGTATTTAACCAAAACCCATCCGAATCAAATCCCATATTCTTCTTCCTGAAAAATCCGCCAGTCCTCTTCTCACCGCAAAAAAAA
Full Trace Sequence: CGGGGGCCCAATAATAGAGTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGACTTTTGTAAATCTGTTTCTGGGACTTTTTATACTTCAAACAGCCTTAGCTGCTCCCACAATTGAGACCATAAACTATGACACGGATACATATGAGGATGTACTGGATAGTCTTTATGACTATGACGAAAATCCTATTGTTGATCAAGGAAAGATAGAGATTGGGACTGTATTACCAGTTGTGAACAGGCCGATCCTTTCACCAGAACAGGTTCCAGAAGAAACAGAAGAGGCAGAAGAATCAACTCCAAAATTAATTGATGGTTCTTCACCACAGGGACCCTTGACTCCTGGAGTCCAAGGTCCAGACACAAGTGGAGCCATTTCACCAACGTGTATTCTGTGTGCTTGCCTCATTACAACCGTTTACTGCGATGACCACAATCTTGATACCATCCCTCCTCTTCCCAAAGAAACCACTCATGTCTACTTGCGTTTCAACAGAATTAGCAAAATAAGCAAACATGACTTTAATCATCTAACTAAATTAAAGAAGATTGACTTGACGTCGAACATCATATCTGAGATCGATGAAGATGCCTTTAGGAATCTGCCTCAACTGTCTGAACTCATACTCCGAGATAATAACATAAGGCAACTTCCAGAGCTTCCCAATACCATGAACTTCATTGATGTCAGCAACAACAGACTTGGTTCTAAAGGAATAAAGAAAGAGGCATTCAAGGACATGACAAATCTTCACATTTTGTATTTAACCAAAACCCATCCGAATCAAATCCCATATTCTTCTTCCTGAAAAATCCGCCAGTCCTCTTCTCACCGCAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGACTTTTGTAAATCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839998
dbEST ID: 79657700
Trimmed Sequence: GACAAGTCTGCCTATTGGTATACGAGGCAGACACATGAAAGCTTGGGGTGTTCTGCTCAGGTTGATGGGGTTGCCATCAAGCCTAATGTCTTCCAGAGTCCTGCGAGCATATGTCCAGTCCTTCATTTTGCAGAATGTATCCTCATGCATTTCCTGGATATTGTTATCTTGCAGGTGAAGAGACTGCAGATTGTCAGGAAGAAGAATAGGGATGTGATTCAGATGGTTATTGGTTAAATACAAAATGTGAAGATCTGTCATGTCCTTGAATGCCTCTTGCTTTATTCCTTTAGAACCAAGTCTGTTGTTGCTGACATCAATGAAGTTCATGGTATTGGGAAGCTCTGGAAGTTGCCTTATGTTATTATCTCGGAGTATGAGCTCAGACAGTTGAGGCAGATTCCTAAAGGCATCTTCATCGATCTCAGATATGATGTTCGACGTCAAGTCAATCTTCTTTAATTTAGTTAGATGATTAAAGTCATGTTTGCTTATTTTGCTAATTCTGTTGAAACGCACGTAGACATGAATGGTTTCTTTGGGAAGAGGAGGGATGGTATCAAGATTGTGGTCATCGCAGTAAACAGGTTTAATGGAGCAAGCACACAGAATACACCTTGATAAAAAGGGTCCCCATGGGGCCCTGAACTTTGACTCCAGTAATCAAGGGTCCGCTGTGCTGAAAACCCCAGCAATAAAAT
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACAAGTCTGCCTATTGGTATACGAGGCAGACACATGAAAGCTTGGGGTGTTCTGCTCAGGTTGATGGGGTTGCCATCAAGCCTAATGTCTTCCAGAGTCCTGCGAGCATATGTCCAGTCCTTCATTTTGCAGAATGTATCCTCATGCATTTCCTGGATATTGTTATCTTGCAGGTGAAGAGACTGCAGATTGTCAGGAAGAAGAATAGGGATGTGATTCAGATGGTTATTGGTTAAATACAAAATGTGAAGATCTGTCATGTCCTTGAATGCCTCTTGCTTTATTCCTTTAGAACCAAGTCTGTTGTTGCTGACATCAATGAAGTTCATGGTATTGGGAAGCTCTGGAAGTTGCCTTATGTTATTATCTCGGAGTATGAGCTCAGACAGTTGAGGCAGATTCCTAAAGGCATCTTCATCGATCTCAGATATGATGTTCGACGTCAAGTCAATCTTCTTTAATTTAGTTAGATGATTAAAGTCATGTTTGCTTATTTTGCTAATTCTGTTGAAACGCACGTAGACATGAATGGTTTCTTTGGGAAGAGGAGGGATGGTATCAAGATTGTGGTCATCGCAGTAAACAGGTTTAATGGAGCAAGCACACAGAATACACCTTGATAAAAAGGGTCCCCATGGGGCCCTGAACTTTGACTCCAGTAATCAAGGGTCCGCTGTGCTGAAAACCCCAGCAATAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACAAGTCTGCCTATTGGTA