ORFeome > ercc1 ORF1 – XORFeome v1.0

ercc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ercc1
Gene ID: 5895512
Gene Page ID: 5895461
ORF Xenbase ID: 17274579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043824
Original XGC clone length: 870

Human orthology & disease relationships

NCBI Entrez ID: 2067
Ensembl gene IDs: ENSG00000012061
Directly associated (OMIM) disease MIM numbers: 610758
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11013
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ824159
dbEST ID: 79641861
Trimmed Sequence: ATGGAAGAAAAAAATTATAATTCAAGAGAAGGAGGACTCCAAAGATTTCTTATTCCATCACCATCATCCATCACCCAGGAGGCAGTTTCTCAACCGAAATGCTCGTTCTTTCAGGCCTCAGAAAAAGTAGAAACAGTCCCAAAAGCTGGGAGTTATGCAGATTACATTTTTCAGAAGGAGGCATGGGATCCTGTACAAAAAGGCCAATTTAGCAATATGGCTGCAAGTGAAAATGCAGTTTCTATTGTGAAGCAAACAACAAATCAAACCACAAAGTCCGCAGGAGCGGGAAGCTGCATTCTTGTCAGCACCCGACAGAGAGGAAACTCGCTACTTAAATATTTGCGAAATGTACCATGGGAGTTCAGTGACATTGTTCCAGACTATATACTTGGGGAAACCTGCTGTTCTCTCTTTCTGAGTCTACGATACCATAATCTGAATCCAGAGTACATACACTCTCGTCTGAGGTCCCTTGGTCAATCCTTTGCACTTCGTGTGCTTCTTGTACAAGTGGACGTGAAAGACCCTCATTTTTCCCCTTAAGAGTTGGCAGAGATCTGTATCCTGTCTGATTGCACACTAATACTGAGCTGGAGTCCTGAGGAGGCTGCTCGGTACCTGAGACATATAAATGTTATGAACAGAAACCTGCAGATGCTCTGAAAGAAGGACTGAGAGGGACTCATGTCACCAATGAAGAATGTCCTCCAACCGTTAAATTAAGTAAACAAACAAAAGCCGCCCCCTTTAATCCCCTTTGGGAAACCGTTTGACCCTCCCAAAGGCCCCGGGGAAAAATTTCCTTTTTTCCCGGGGCC
Full Trace Sequence: ACTGGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGAAAAAAATTATAATTCAAGAGAAGGAGGACTCCAAAGATTTCTTATTCCATCACCATCATCCATCACCCAGGAGGCAGTTTCTCAACCGAAATGCTCGTTCTTTCAGGCCTCAGAAAAAGTAGAAACAGTCCCAAAAGCTGGGAGTTATGCAGATTACATTTTTCAGAAGGAGGCATGGGATCCTGTACAAAAAGGCCAATTTAGCAATATGGCTGCAAGTGAAAATGCAGTTTCTATTGTGAAGCAAACAACAAATCAAACCACAAAGTCCGCAGGAGCGGGAAGCTGCATTCTTGTCAGCACCCGACAGAGAGGAAACTCGCTACTTAAATATTTGCGAAATGTACCATGGGAGTTCAGTGACATTGTTCCAGACTATATACTTGGGGAAACCTGCTGTTCTCTCTTTCTGAGTCTACGATACCATAATCTGAATCCAGAGTACATACACTCTCGTCTGAGGTCCCTTGGTCAATCCTTTGCACTTCGTGTGCTTCTTGTACAAGTGGACGTGAAAGACCCTCATTTTTCCCCTTAAGAGTTGGCAGAGATCTGTATCCTGTCTGATTGCACACTAATACTGAGCTGGAGTCCTGAGGAGGCTGCTCGGTACCTGAGACATATAAATGTTATGAACAGAAACCTGCAGATGCTCTGAAAGAAGGACTGAGAGGGACTCATGTCACCAATGAAGAATGTCCTCCAACCGTTAAATTAAGTAAACAAACAAAAGCCGCCCCCTTTAATCCCCTTTGGGAAACCGTTTGACCCTCCCAAAGGCCCCGGGGAAAAATTTCCTTTTTTCCCGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGAAAAAAATTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829464
dbEST ID: 79647166
Trimmed Sequence: GTCTCCGATTCTCAACTCTCCTAGCAATTTCTGGGGTCCGAGGCCAGGGCATAAAGAAAGATCTTCACGTGATGCATTTGCAAGGTCAAACAGAGTCCCAAACGTGGTAAATAGAGTGCAGCTGTCTGTCTTGTTTACATACTTAACAGTTGTGAGACACTCTGTCATCGTAGACATGAAGTCCTTCTCAGTTCTTTCTTTCAGAGCATCTGCAGGTTTCTGTTCATAACATTTATATGTCTCAAGGTACCGAGCAGCCTCCTCAGGACTCCAGCTCAGTATTAGTGTGCAATCAGACAGGATACAGATCTTTGCCAACTCTTTAAGGGAAAAATGAGGGTCTTTCACGTCCACTTGTACAAGAAGCACACGAAGTGCAAAGGATTGACCAAGGGACCTCAGACGAGAGTGTATGTACTCTGGATTCAGATTATGGTATCGTAGACTCAGAAAGAGAGAACAGCAGGTTTCCCCAAGTATATAGTCTGGAACAATGTCACTGAACTCCCATGGTACATTTCGCAAATATTTAAGTAGCGAGTTTCCTCTCTGTCGGGTGCTGACAAGAATGCAGCTTCCCGCTCCTGCGGACTTTGTGGTTTGATTTGTTGTTTGCTTCACAATAGAAACTGCATTTTCACTTGCAGCCATATTGCTAAATTGGGCCTTTTTGTCCAGGGATCCCATGCCTCCCTTCCTGAAAAATGTTAATCCGCAATAACTCCCCAACCTTTTTGGGGAACTGGTTTTCCTCCTTTTTTTC
Full Trace Sequence: TGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTCCGATTCTCAACTCTCCTAGCAATTTCTGGGGTCCGAGGCCAGGGCATAAAGAAAGATCTTCACGTGATGCATTTGCAAGGTCAAACAGAGTCCCAAACGTGGTAAATAGAGTGCAGCTGTCTGTCTTGTTTACATACTTAACAGTTGTGAGACACTCTGTCATCGTAGACATGAAGTCCTTCTCAGTTCTTTCTTTCAGAGCATCTGCAGGTTTCTGTTCATAACATTTATATGTCTCAAGGTACCGAGCAGCCTCCTCAGGACTCCAGCTCAGTATTAGTGTGCAATCAGACAGGATACAGATCTTTGCCAACTCTTTAAGGGAAAAATGAGGGTCTTTCACGTCCACTTGTACAAGAAGCACACGAAGTGCAAAGGATTGACCAAGGGACCTCAGACGAGAGTGTATGTACTCTGGATTCAGATTATGGTATCGTAGACTCAGAAAGAGAGAACAGCAGGTTTCCCCAAGTATATAGTCTGGAACAATGTCACTGAACTCCCATGGTACATTTCGCAAATATTTAAGTAGCGAGTTTCCTCTCTGTCGGGTGCTGACAAGAATGCAGCTTCCCGCTCCTGCGGACTTTGTGGTTTGATTTGTTGTTTGCTTCACAATAGAAACTGCATTTTCACTTGCAGCCATATTGCTAAATTGGGCCTTTTTGTCCAGGGATCCCATGCCTCCCTTCCTGAAAAATGTTAATCCGCAATAACTCCCCAACCTTTTTGGGGAACTGGTTTTCCTCCTTTTTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTCCGATTCTCAACTCT