ORFeome > erlec1 ORF1 – XORFeome v1.0

erlec1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: erlec1
Gene ID: 989161
Gene Page ID: 989154
ORF Xenbase ID: 17274645

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124843
Original XGC clone length: 1443

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ838227
dbEST ID: 79655929
Trimmed Sequence: ATGCGCAGGAGCGACAGGTTCCCGTGTGCCGGTGCCTCGCTGCTCGTGGTCTTATGCGGCGTGTTCCCTTCTTCCTTTGGAGGCAGAACGCTCCCGGGCCTCAGCGATGACATCCCTTTCCGGCTCAAGTGGCCCGGGCCGGACTACTTTCAATCCCCAACTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTGGCACCATGCGCAGGAGCGACAGGTTCCCGTGTGCCGGTGCCTCGCTGCTCGTGGTCTTATGCGGCGTGTTCCCTTCTTCCTTTGGAGGCAGAACGCTCCCGGGCCTCAGCGATGACATCCCTTTCCGGCTCAAGTGGCCCGGGCCGGACTACTTTCAATCCCCAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCATGTCTCAAAATATCTGATGTTACAAAGAACAATTGCCCGGGCTTGCCTGTACTCGGCATGAATACAATGGACCGACCTGGAAAAAACACGCGTTTACTTTTTTGCCACCCTAGGGAGATAAGAAGAAGCACAAAAATGAAAAGAAAACAAGGGCATGAATTCATAAGAATGAAAGCCAGTTCCGGAATGGAGACCTGAAATGGGACCAGAACCATGGGCTAAACCCAACTGGGGAAAAACCCTTGACCGATTTTATCGGTGGGTAAAGGTTTTTTTTGTGGGTTTTATTTGTTTGTTAAGAACTTGTTTTTTTGGGGCTTCTTTCCCAGGGCCCTGGGGTTATAAAAGCTGGGAAAACCCGTTTATGCCGTGGGGTCCCAGTGTTCTATTTTTAAAAGAATAAAATAATATAGTATTGGAGTCGAGGGTGGGGGCGGATTTCCTCCCACAAAACAAAACTAATAAAAAAAGTTTGTGTGGTGGGGGGAGAGGCGGGGTGGTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGCAGGAGCGACAGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838226
dbEST ID: 79655928
Trimmed Sequence: GTTGGGGATTGAAAGTAGTCCGGCCCGGGCCACTTGAGCCGGAAAGGGATGTCATCGCTGAGGCCCGGGAGCGTTCTGCCTCCAAAGGAAGAAGGGAACACGCCGCATAAGACCACGAGCAGCGAGGCACCGGCACACGGGAACCTGTCGCTCCTGCGCATGG
Full Trace Sequence: AAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGGGATTGAAAGTAGTCCGGCCCGGGCCACTTGAGCCGGAAAGGGATGTCATCGCTGAGGCCCGGGAGCGTTCTGCCTCCAAAGGAAGAAGGGAACACGCCGCATAAGACCACGAGCAGCGAGGCACCGGCACACGGGAACCTGTCGCTCCTGCGCATGGTGCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGTCGTTTTACAACAAAAAGACAAGAGAAAAGAAAAACAATAGGAGCCGCCTGAAACGCCTCAAAAAGAAAGGAGCGGGCTTCCAAACACCGCGCTTTGCTTGGGCGGATGACTGGGGGATAGCAAATAAACGGGAAGGCCCTAAGACCACGGGCTCGTAGATTACAGTTTTTAAAACCGGGGAACGGGAGTGCCCCTGTCCAGGAGGCCACAACACCTGACGGACGCCAACGGGTGAATAAGGGCTGAGGGGGGGTTTCCGGTGTTTGAAGAGACTTTTNCTTGGTGTGGAAAATTATGCCCCGCAGGGCCCCAAACAAACAGGCGGTCTCCCGCCGGGGGGGATATTTTGGAGAATGAANAAACCAAACCACGGTNGGACACGACACGAGNGCGCCCTCCNTCAACAAAATAAAAAGATATTGGAGGATGGGGGAGGGGGGGGGGGGGGGGGAGANNAGTNNGNACAAAAAAGAAAAANAAGANANGGGGGGAGGGGGGGCGAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGGGATTGAAAGTAGTCCGT