ORFeome > erp44 ORF1 – XORFeome v1.0

erp44 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: erp44
Gene ID: 962194
Gene Page ID: 962187
ORF Xenbase ID: 17274675

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106629
Original XGC clone length: 1221

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ837644
dbEST ID: 79655346
Trimmed Sequence: ATGAGACGCTATAGCTTCGTCCCTTACTTTTACCCGGCGTACTTTTTCATGCTACTGATAATGTGCGTTTTCACTCCAGTAAAAAGTGAAATAATTACCTTAGAGAGTGGCAATATAGATGACATTTTAAGAAATGCTGATGTTGCTTTAGTGAATTTCTATGCTGACTGGTGCCGATTCAGTCAAATGCTGCACCCTATATTTGAAGAAGCATCTAATATAATACAAGAAGAATATCCTGATAAAAATAAAGTTGTTTTTGCAAGAGTGGACTGTGATCAACACTCTGAAATAGCACAAAGATACAGGATCAGTAAATATCCTACACTAAAGCTTTTCAGAAATGGAATGATGATGAAAAGAGAATACAGGGGGCAGCGGTCAGTTACTGCAATTGCAGACTACATTAGACAGCAAAAGAGTAACCCTATACGTGAAGTTGGTGACCTGGAAGAATTAAAAACTGTTGATCGCAGTAAAAGAAATATAATTGGCTTTTTTGAAAGCAAAGAAACAGACAACTTCAGGACCTTTGAAAAAGTATCAAATATTTTGCATGATGATTGTGTCTTCCTTGCTGCATTTGGTGATGTAGCGAAGCCAAGAGGGTTTAGTGGTGAACATGTAATCTACAGACCTATTTGGGGAAAATGCTCCAGACATGGTTTATTTGGGATCATTAGCCAACTTTGACCTGACGTTTGCATTGACACCAAAAAAAATGTGTCCCCCCTTTGTAGA
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGACGCTATAGCTTCGTCCCTTACTTTTACCCGGCGTACTTTTTCATGCTACTGATAATGTGCGTTTTCACTCCAGTAAAAAGTGAAATAATTACCTTAGAGAGTGGCAATATAGATGACATTTTAAGAAATGCTGATGTTGCTTTAGTGAATTTCTATGCTGACTGGTGCCGATTCAGTCAAATGCTGCACCCTATATTTGAAGAAGCATCTAATATAATACAAGAAGAATATCCTGATAAAAATAAAGTTGTTTTTGCAAGAGTGGACTGTGATCAACACTCTGAAATAGCACAAAGATACAGGATCAGTAAATATCCTACACTAAAGCTTTTCAGAAATGGAATGATGATGAAAAGAGAATACAGGGGGCAGCGGTCAGTTACTGCAATTGCAGACTACATTAGACAGCAAAAGAGTAACCCTATACGTGAAGTTGGTGACCTGGAAGAATTAAAAACTGTTGATCGCAGTAAAAGAAATATAATTGGCTTTTTTGAAAGCAAAGAAACAGACAACTTCAGGACCTTTGAAAAAGTATCAAATATTTTGCATGATGATTGTGTCTTCCTTGCTGCATTTGGTGATGTAGCGAAGCCAAGAGGGTTTAGTGGTGAACATGTAATCTACAGACCTATTTGGGGAAAATGCTCCAGACATGGTTTATTTGGGATCATTAGCCAACTTTGACCTGACGTTTGCATTGACACCAAAAAAAATGTGTCCCCCCTTTGTAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGACGCTATAGCTTCGTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837643
dbEST ID: 79655345
Trimmed Sequence: AAGTTCATCGCGATCTCTATTCAGGATAGTGTACCTATGTTCACTTGGAGCCAGTTTCTGGAAGGAGCTATCTGGAGGATTACTTATATCTTCAGTTGGCTGATCGGGGGAAACATCTGTAGGGTCTGGTCCATGGTGAAATTCCCTATGCAGTTTCCCAGAGTGTAGGTCTAGTATAAATTGTTTTAGTTTACCAGAAATTGACAAATCTTTAAAATCTGGAAAGACATACATATGTCTAAAGCTATCAATGGCTATTACAGGACAATCAGCAGGTGTCTTCTGTATGTGCAGAAGAGGGTGCCTAAATTTCTCACAGTCTGCATGTAGAAAATTTATTGTTCCCTTTTCACTTATCAATTGTCGGGCAACCTCTTGTTGGAATTTTTCTAGGCTTGCAGTATCATCTTTTACATGGAAAAGTATTAGAAACGGAAGACCTTCTTCTGTCAGCTCCTCTCCATTTTCAAATGTTATTTCTCTAACAAGGGGGACACATTTATCTTGTGTCCATGCAAACGTCAGGTCAAAGTTGGTTAATGATCCCAAATAAACCATGTCTGGAGCATTCTCCCCAATAGGTCTGTAGATTACATTGTCACCACTAAACCTCTCTGGCTTTGCTACATCACCAAATGCAGCAGGGAAGACACAATCATCATGCAAAATATTTGATACTTTTTCAAAGGTCCTGAAGTTGTCTGTTTCTTTGCTTTCAAAAAGCCAATTATAATTCTTTTACTGCGATCAACAGTTTTTAAATCTTCCAGGTCCCCCACCTCACCTATAAGGTTACTCTTTTGCTGTCTAATGTAGTCTGCATTTCAATAACTTGACCCCTCCCCCCTGTATCCCCTTTCATCATCCTTCCTTTTCTGAAAACATTAAATGAGGAAATTAACTGACCCTGTCCCTTGGTCTTTTTCTGAAGGGTTAAATAAAGCCGACTCCTTCAAAAAAAACTTAAATTTTTATTAGAAATTTCTTTTTGTGTTTAAATTAAAAGGGTTTCTTCAAATAAGGGGGGGCAAACGTTTGAACTGGAAGGGCGCACCAGTTTCCCCCAAAAAACTTCCCATAAACCCCAACATCAAACAATTTTTTTATTAAAATGTTTATTTTTTTAATTTTTTCCCCCCTCCCTTGCTTAGGTGTATATTATTTTTTGTTTCGCCATATTTTGTTTTTTATGGGGGGGGAAAAGAA
Full Trace Sequence: GGGACGGGTAATCAGCTATGGACCATGTAATACGACTCACTATGAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTTCATCGCGATCTCTATTCAGGATAGTGTACCTATGTTCACTTGGAGCCAGTTTCTGGAAGGAGCTATCTGGAGGATTACTTATATCTTCAGTTGGCTGATCGGGGGAAACATCTGTAGGGTCTGGTCCATGGTGAAATTCCCTATGCAGTTTCCCAGAGTGTAGGTCTAGTATAAATTGTTTTAGTTTACCAGAAATTGACAAATCTTTAAAATCTGGAAAGACATACATATGTCTAAAGCTATCAATGGCTATTACAGGACAATCAGCAGGTGTCTTCTGTATGTGCAGAAGAGGGTGCCTAAATTTCTCACAGTCTGCATGTAGAAAATTTATTGTTCCCTTTTCACTTATCAATTGTCGGGCAACCTCTTGTTGGAATTTTTCTAGGCTTGCAGTATCATCTTTTACATGGAAAAGTATTAGAAACGGAAGACCTTCTTCTGTCAGCTCCTCTCCATTTTCAAATGTTATTTCTCTAACAAGGGGGACACATTTATCTTGTGTCCATGCAAACGTCAGGTCAAAGTTGGTTAATGATCCCAAATAAACCATGTCTGGAGCATTCTCCCCAATAGGTCTGTAGATTACATTGTCACCACTAAACCTCTCTGGCTTTGCTACATCACCAAATGCAGCAGGGAAGACACAATCATCATGCAAAATATTTGATACTTTTTCAAAGGTCCTGAAGTTGTCTGTTTCTTTGCTTTCAAAAAGCCAATTATAATTCTTTTACTGCGATCAACAGTTTTTAAATCTTCCAGGTCCCCCACCTCACCTATAAGGTTACTCTTTTGCTGTCTAATGTAGTCTGCATTTCAATAACTTGACCCCTCCCCCCTGTATCCCCTTTCATCATCCTTCCTTTTCTGAAAACATTAAATGAGGAAATTAACTGACCCTGTCCCTTGGTCTTTTTCTGAAGGGTTAAATAAAGCCGACTCCTTCAAAAAAAACTTAAATTTTTATTAGAAATTTCTTTTTGTGTTTAAATTAAAAGGGTTTCTTCAAATAAGGGGGGGCAAACGTTTGAACTGGAAGGGCGCACCAGTTTCCCCCAAAAAACTTCCCATAAACCCCAACATCAAACAATTTTTTTATTAAAATGTTTATTTTTTTAATTTTTTCCCCCCTCCCTTGCTTAGGTGTATATTATTTTTTGTTTCGCCATATTTTGTTTTTTATGGGGGGGGAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTCATCGCGATCTCTATTCA