ORFeome > esd ORF1 – XORFeome v1.0

esd ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: esd
Gene ID: 952578
Gene Page ID: 952571
ORF Xenbase ID: 17274687

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078560
Original XGC clone length: 849

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ839767
dbEST ID: 79657469
Trimmed Sequence: ATGGCCTTAAAGGAGATTTCAAGCAACAAGTGTTTTGAGGGATTCCAAAAGGTGTTTGAACATGACAGCACTGAACTGAAATGGCCAGATGAAGTTTGGAATTTATTTGCCTCAGAAAGCTGAAAGCATAAAATGTCCAGTTATTTACTGGCTTTCAGGATTAACATGTACGGAGCAAAACTTTATCACAAAAGCAGCTTTTCATCAAGCTGCCTCTGAGCATGGACTTATCATAGTAGCACCAGATACCAGCCCACGTGGCTGCAACATAGATGGAGAAGAGGAGAGCTGGGATTTTGGTACAGGAGCTGGATTCTATGTCAATGCCACTGAAGATCTTTGGAAAACAAACTACAGAATGTATTCATACATAGTAGATGAGCTTCCACATCTTATAAATGGTAATTTCCCAACGGATCCAGATCGGGTTTCCATTTTTGGCCATTCCATGGGAGGGCATGGTGCGTTAATCTGTGCGCTGAAAAACCCAGGGAAATATAAGACCGTGTCAGCATTCGCACCCATCTGTAATCCTACTCAGTGCCCATGGGGCCAAAAAGCATTCAATGGTTACCTGGGACCAGACACCAGCAAATGGGAGGCATATGATGNCACCCAACTGGGTGAAGAATTACTCTGGCCCAAAACTAGATATATTAATAAATTCAAGGAAAAAATGACAGTTTCCCGCCTGCCGGGCAGTTACTGCCAAACATTTTTATGGCCCCTGCCCCACCCCAACATTCCCTGTTGGTTTTAAGCCTGCCAGAGGGAAACGGATTCGCGGCCACCTTTTTTTTCCCCCCCTTCCAAAAATTAAACCACACCAGGC
Full Trace Sequence: GGGGGCCCCAATAATTGATTTTATTTCTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTTAAAGGAGATTTCAAGCAACAAGTGTTTTGAGGGATTCCAAAAGGTGTTTGAACATGACAGCACTGAACTGAAATGGCCAGATGAAGTTTGGAATTTATTTGCCTCAGAAAGCTGAAAGCATAAAATGTCCAGTTATTTACTGGCTTTCAGGATTAACATGTACGGAGCAAAACTTTATCACAAAAGCAGCTTTTCATCAAGCTGCCTCTGAGCATGGACTTATCATAGTAGCACCAGATACCAGCCCACGTGGCTGCAACATAGATGGAGAAGAGGAGAGCTGGGATTTTGGTACAGGAGCTGGATTCTATGTCAATGCCACTGAAGATCTTTGGAAAACAAACTACAGAATGTATTCATACATAGTAGATGAGCTTCCACATCTTATAAATGGTAATTTCCCAACGGATCCAGATCGGGTTTCCATTTTTGGCCATTCCATGGGAGGGCATGGTGCGTTAATCTGTGCGCTGAAAAACCCAGGGAAATATAAGACCGTGTCAGCATTCGCACCCATCTGTAATCCTACTCAGTGCCCATGGGGCCAAAAAGCATTCAATGGTTACCTGGGACCAGACACCAGCAAATGGGAGGCATATGATGNCACCCAACTGGGTGAAGAATTACTCTGGCCCAAAACTAGATATATTAATAAATTCAAGGAAAAAATGACAGTTTCCCGCCTGCCGGGCAGTTACTGCCAAACATTTTTATGGCCCCTGCCCCACCCCAACATTCCCTGTTGGTTTTAAGCCTGCCAGAGGGAAACGGATTCGCGGCCACCTTTTTTTTCCCCCCCTTCCAAAAATTAAACCACACCAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTTAAAGGAGATTTCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839766
dbEST ID: 79657468
Trimmed Sequence: GACATGAAGGTATTTCACATGGTGCTTGATGTGATCATTTATGAAAGTGGTGATAAAAAAGTAGCTGTGATCGTATCCCTCTTGCAGCCTAAAAACAACAGGGATGTTGCGCTCGGTGCAAGCGGCAATAAAATTGTCTGGCAGTAACTGCCCGGCAGCGAGGAACTGGTCATCTTTTCCTTGATCTATTAATATATCTAGTTTTGGGCCAGAGTAATTCTTCACCAGTTGGGTTGCATCATATGCCTCCCATTTGCTGGTGTCTGGTCCCAGGTAACCATTGAATGCTTTTTGGCCCCATGGGCACTGAGTAGGATTACAGATGGGTGCGAATGCTGACACGGTCTTATATTTCCCTGGGTTTTTCAGCGCACAGATTAACGCACCATGCCCTCCCATGGAATGGCCAAAAATGGAAACCCGATCTGGATCCGTTGGGAAATTACCATTTATAAGATGTGGAAGCTCATCTACTATGTATGAATACATTCTGTAGTTTGTTTTCCAAAGATCTTCAGTGGCATTGACATAGAATCCAGCTCCTGTACCAAAATCCCAGCTCTCCTCTTCTCCTCTATGTTGCAACCACGTGGGCTGGTTTCTGGTGCTACTATGATAAGTCCATGCTCAGAGGCCGCTTGAATGAAAGCTGCTTTTTGTATAAAGTTTTGCCTCCTTAATGGTAAATCCCTGAAGCCAAATAAAAAAACTGGAAATTTTAAGCCTTTTCAACCTTTTCTAAAGGCCAAATAAATTTCCAAAACATTCCATCTT
Full Trace Sequence: CGGGGAAACAGCTATTGACCATGTAATACGACTCACTATAGAGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACATGAAGGTATTTCACATGGTGCTTGATGTGATCATTTATGAAAGTGGTGATAAAAAAGTAGCTGTGATCGTATCCCTCTTGCAGCCTAAAAACAACAGGGATGTTGCGCTCGGTGCAAGCGGCAATAAAATTGTCTGGCAGTAACTGCCCGGCAGCGAGGAACTGGTCATCTTTTCCTTGATCTATTAATATATCTAGTTTTGGGCCAGAGTAATTCTTCACCAGTTGGGTTGCATCATATGCCTCCCATTTGCTGGTGTCTGGTCCCAGGTAACCATTGAATGCTTTTTGGCCCCATGGGCACTGAGTAGGATTACAGATGGGTGCGAATGCTGACACGGTCTTATATTTCCCTGGGTTTTTCAGCGCACAGATTAACGCACCATGCCCTCCCATGGAATGGCCAAAAATGGAAACCCGATCTGGATCCGTTGGGAAATTACCATTTATAAGATGTGGAAGCTCATCTACTATGTATGAATACATTCTGTAGTTTGTTTTCCAAAGATCTTCAGTGGCATTGACATAGAATCCAGCTCCTGTACCAAAATCCCAGCTCTCCTCTTCTCCTCTATGTTGCAACCACGTGGGCTGGTTTCTGGTGCTACTATGATAAGTCCATGCTCAGAGGCCGCTTGAATGAAAGCTGCTTTTTGTATAAAGTTTTGCCTCCTTAATGGTAAATCCCTGAAGCCAAATAAAAAAACTGGAAATTTTAAGCCTTTTCAACCTTTTCTAAAGGCCAAATAAATTTCCAAAACATTCCATCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACATGAAGGTATTTCACATGG