ORFeome > etfb ORF1 – XORFeome v1.0

etfb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: etfb
Gene ID: 956105
Gene Page ID: 956097
ORF Xenbase ID: 17274729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059787
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID: 2109
Ensembl gene IDs: ENSG00000105379
Directly associated (OMIM) disease MIM numbers: 231680
Indirectly associated (Lage, et al.) disease MIM numbers: 201450,201460,231680,264470,300194,300387,604387,606054,609015

Library Location

Plate ID: GDExl11018
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ824495
dbEST ID: 79642197
Trimmed Sequence: ATGGCGCTGCGGGCTTTGGTTGGTGTCAAGCGGGTCATTGACTATGCAGTGAAGGTGCGGGTGAAGCCTGATAAGACTGGGGTGGTGACAGATGGGGTGAAGCACTCTATGAATCCCTTCTGTGAGATTGCCGTGGAAGAGGCAGTGAGGCTGAAGGAGAAAAAGATTGTCGGTGAAATCATCGCCGTAAGCTGCGGCCCACAGCAATGCCAGGAGACCATCCGAACGGCTTTGGCCATGGGAGCAGACCGAGGAATTCACGTGGACGTTCCTGCAAAGGATGTTGGGAGCCTCGGACCATTCCAGGTCTCCAAGATCATGGCAGCACTAGCAAAAAAAGAGAATGTGAATCTTGTGCTGCTGGGGAAACAGGCCATTGATGATGACTGTAACGAGACCGGACAGATGACCGCAGCTCTGCTTGACTGGCCTCAGGGGACATTCGCCTCAGAAGTGAAAGTGGAAGGAGAGAAGTTGACGGTCGTGCGAGAAGTAGACGGGGGGCTTGAGACCATCAGCCTTAAACTCCCTGCAGTGGTCACCGCTGACTTGCGTCTGAACGAGCCGCGTTACGCCACTCTTCCTAATATCATGAAAGCCAAAAAGAAGAAAATCGAGACGGTGAAACCGTCAGATCTGGGAGTCGACATCACAAGCCGGATACGTATTTTTAGCGTGGAAGATCCCCCCCAAGAACAGCTGGTGTCAAAGTAGAACAGTAGAGGACGTTGTATCCNAGTTGAANNGAAGTGGGCGAATATTGCCAACTTTTCTTGTC
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCGGGCTTTGGTTGGTGTCAAGCGGGTCATTGACTATGCAGTGAAGGTGCGGGTGAAGCCTGATAAGACTGGGGTGGTGACAGATGGGGTGAAGCACTCTATGAATCCCTTCTGTGAGATTGCCGTGGAAGAGGCAGTGAGGCTGAAGGAGAAAAAGATTGTCGGTGAAATCATCGCCGTAAGCTGCGGCCCACAGCAATGCCAGGAGACCATCCGAACGGCTTTGGCCATGGGAGCAGACCGAGGAATTCACGTGGACGTTCCTGCAAAGGATGTTGGGAGCCTCGGACCATTCCAGGTCTCCAAGATCATGGCAGCACTAGCAAAAAAAGAGAATGTGAATCTTGTGCTGCTGGGGAAACAGGCCATTGATGATGACTGTAACGAGACCGGACAGATGACCGCAGCTCTGCTTGACTGGCCTCAGGGGACATTCGCCTCAGAAGTGAAAGTGGAAGGAGAGAAGTTGACGGTCGTGCGAGAAGTAGACGGGGGGCTTGAGACCATCAGCCTTAAACTCCCTGCAGTGGTCACCGCTGACTTGCGTCTGAACGAGCCGCGTTACGCCACTCTTCCTAATATCATGAAAGCCAAAAAGAAGAAAATCGAGACGGTGAAACCGTCAGATCTGGGAGTCGACATCACAAGCCGGATACGTATTTTTAGCGTGGAAGATCCCCCCCAAGAACAGCTGGTGTCAAAGTAGAACAGTAGAGGACGTTGTATCCNAGTTGAANNGAAGTGGGCGAATATTGCCAACTTTTCTTGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCGGGCTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829848
dbEST ID: 79647550
Trimmed Sequence: TATTCGCCCACTTTCCTTCAACTTGGATACAAGGTCCTCTACTGTTTCTACTTTGACACCAGCTTGTCTTTGGGGGGGATCTTCCACGCTTAAAATACGTATCCGGCTTGTGATGTCGACTCCCAGATCTGACGGTTTCACCGTCTCGATTTTCTTCTTTTTGGCTTTCATGATATTAGGAAGAGTGGCGTAACGCGGCTCGTTCAGACGCAAGTCAGCGGTGACCACTGCAGGGAGTTTAAGGCTGATGGTCTCAAGCCCCCCGTCTACTTCTCGCACGACCGTCAACTTCTCTCCTTCCACTTTCACTTCTGAGGCGAATGTCCCCTGAGGCCAGTCAAGCAGAGCTGCGGTCATCTGTCCGGTCTCGTTACAGTCATCATCAATGGCCTGTTTCCCCAGCAGCACAAGATTCACATTCTCTTTTTTTGCTAGTGCTGCCATGATCTTGGAGACCTGGAATGGTCCGAGGCTCCCAACATCCTTTGCAGGAACGTCCACGTGAATTCCTCGGTCTGCTCCCATGGCCAAAGCCGTTCGGATGGTCTCCTGGCATTGCTGTGGGCCGCAGCTTACGGCGATGATTTCACCGACAATCTTTTTCTCCTTCAGCCTCACTGCCTCTTTCACGGACATCTCACAGAAGGGGATTCATAGAGTGCCTTCACCCCATCTTGTCACCACCCCATTCCTATTCAAGGCTCCCCCCGGACCCCTCCCCTGCAAAATTCAAAGAACCCCCTTTGGAACACCAACCCAAACCCCGCCAA
Full Trace Sequence: CGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTCGCCCACTTTCCTTCAACTTGGATACAAGGTCCTCTACTGTTTCTACTTTGACACCAGCTTGTCTTTGGGGGGGATCTTCCACGCTTAAAATACGTATCCGGCTTGTGATGTCGACTCCCAGATCTGACGGTTTCACCGTCTCGATTTTCTTCTTTTTGGCTTTCATGATATTAGGAAGAGTGGCGTAACGCGGCTCGTTCAGACGCAAGTCAGCGGTGACCACTGCAGGGAGTTTAAGGCTGATGGTCTCAAGCCCCCCGTCTACTTCTCGCACGACCGTCAACTTCTCTCCTTCCACTTTCACTTCTGAGGCGAATGTCCCCTGAGGCCAGTCAAGCAGAGCTGCGGTCATCTGTCCGGTCTCGTTACAGTCATCATCAATGGCCTGTTTCCCCAGCAGCACAAGATTCACATTCTCTTTTTTTGCTAGTGCTGCCATGATCTTGGAGACCTGGAATGGTCCGAGGCTCCCAACATCCTTTGCAGGAACGTCCACGTGAATTCCTCGGTCTGCTCCCATGGCCAAAGCCGTTCGGATGGTCTCCTGGCATTGCTGTGGGCCGCAGCTTACGGCGATGATTTCACCGACAATCTTTTTCTCCTTCAGCCTCACTGCCTCTTTCACGGACATCTCACAGAAGGGGATTCATAGAGTGCCTTCACCCCATCTTGTCACCACCCCATTCCTATTCAAGGCTCCCCCCGGACCCCTCCCCTGCAAAATTCAAAGAACCCCCTTTGGAACACCAACCCAAACCCCGCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTCGCCCACTTTCCTTCA