ORFeome > ets1 ORF1 – XORFeome v1.0

ets1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ets1
Gene ID: 6254436
Gene Page ID: 6465483
ORF Xenbase ID: 17274747

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129729
Original XGC clone length: 1317

Human orthology & disease relationships

NCBI Entrez ID: 2113
Ensembl gene IDs: ENSG00000134954
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,180849,209950,240300,245590,259500,300068,308370,312300,313200,606394,607136

Library Location

Plate ID: GDExl11092
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ838922
dbEST ID: 79656624
Trimmed Sequence: ATGAAAGCTGCGCTAGATCTCAAACCGACATTAAGCATCAAAACAGAGAAAGAGTATGAAGCGTATTCGTGCTCGGATATGGAATGTGCAGATGTCCCGCTTCTGACACCCAGTAGTAAAGAGATGATGTCTCAAGCTCTACGTGCCACTTTTAGTGGCTTTACAAAGGAACAACAACGTTTAGGGATCCCCATTGATCCCCGAGAATGGACAGACATGCATGTGAGAGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGCCCTGGGGAAGGAATGCTTCCTAGAACTGGCACCAGACTTTGTGGGAGATATCTTATGGGAGCACTTGGAGATCTTGCAGAAAGACTCAAAACAATACCAGACTAGTGAAATAACCCCAGCATACCCAGAATCAAGATACACTTCAGACTACTTTATCAGTTATGGAATTGAACATGCACAGTGTGTTCCACCCTCTGAATTCTCTGAACCTGGCTTCATCACAGAGTCATATCAGACCTTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTCTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAGGGCGACTACGTCACCATCAAAACAGAGGTAGTGACTCCAGACAACATGTGGCTGGGACGCATCAGTCGTGGGAAAACTTGGTGGGGCAGGAGTCCTTTGAAAGTATTGGAGAACCATGGACGGCTGTTGAACGCCCTCCAAACATTCCTTGGAAGCAACCCAGTCCCTTCAAC
Full Trace Sequence: GACCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAAGCTGCGCTAGATCTCAAACCGACATTAAGCATCAAAACAGAGAAAGAGTATGAAGCGTATTCGTGCTCGGATATGGAATGTGCAGATGTCCCGCTTCTGACACCCAGTAGTAAAGAGATGATGTCTCAAGCTCTACGTGCCACTTTTAGTGGCTTTACAAAGGAACAACAACGTTTAGGGATCCCCATTGATCCCCGAGAATGGACAGACATGCATGTGAGAGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGCCCTGGGGAAGGAATGCTTCCTAGAACTGGCACCAGACTTTGTGGGAGATATCTTATGGGAGCACTTGGAGATCTTGCAGAAAGACTCAAAACAATACCAGACTAGTGAAATAACCCCAGCATACCCAGAATCAAGATACACTTCAGACTACTTTATCAGTTATGGAATTGAACATGCACAGTGTGTTCCACCCTCTGAATTCTCTGAACCTGGCTTCATCACAGAGTCATATCAGACCTTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTCTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAGGGCGACTACGTCACCATCAAAACAGAGGTAGTGACTCCAGACAACATGTGGCTGGGACGCATCAGTCGTGGGAAAACTTGGTGGGGCAGGAGTCCTTTGAAAGTATTGGAGAACCATGGACGGCTGTTGAACGCCCTCCAAACATTCCTTGGAAGCAACCCAGTCCCTTCAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGCTGCGCTAGATCTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838921
dbEST ID: 79656623
Trimmed Sequence: TTCATCAGTGTCTGGTTTAACATCAAGCATGGCGTGCAGTTCTTCTGGTACATATCCCAGAAGACTTTGTAAGTCGCATACAAAACGGTAGACGTATCGCTTTCCTGCTGTTTTGTGAATTATATTTTTGTCATAATAATAGCGGAGCCCACGACTCAACTTCTCATAGTTCATTTTAGGCTTGTTTTTCCTCTTGCCCCAGCGTCTTGCAACCTCATCTGGATCAGACAGCTTAAATTCCCAGCCATCCCCTGTCCAGCTGATAAAGGACTGGCATGATTTGTCTGTCAGTAACTCCAGGAGAAACTGCCACAGCTGAATTGGTCCGCTTCCTGTGTAGCCAGCTAGAGCAGCAGCAGGGATGACAGGTTTGTCTTTGTTGAGTTCCGCTCTGTCCCTTACATAGTCTTTAAAAGTGCCTTTGGATTTATGGCTCGGCATAGCAGGTGGGTAGTCTTCCGAATCAAAACTGTCATAAGATGGCACACGTTGAAGGCTGTTGTATGAGGACTGGCTGCTCCAAGACTGTGTGAGGCGGTCACAGCTGTCATGGCTCTCAATACTTTCAAAGGACTCCTGCCCACCAAGTTTTCCACGACTGATGCGTCCCAGGCACATGTTGTCTGGAGTCACTACCTCCTGTTTTGATGGTGAAATTAGTCGCCCTGAAAAAAATTCAGGCTGCAAGGGGGTCACGCCACCAGTTCCTAGAAGGGTAATTCATTTCTCATAATTTTCAAAAAAAAAAATTTCCTTCTAAAACTGAAAGGGAAGTGC
Full Trace Sequence: GAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCAGTGTCTGGTTTAACATCAAGCATGGCGTGCAGTTCTTCTGGTACATATCCCAGAAGACTTTGTAAGTCGCATACAAAACGGTAGACGTATCGCTTTCCTGCTGTTTTGTGAATTATATTTTTGTCATAATAATAGCGGAGCCCACGACTCAACTTCTCATAGTTCATTTTAGGCTTGTTTTTCCTCTTGCCCCAGCGTCTTGCAACCTCATCTGGATCAGACAGCTTAAATTCCCAGCCATCCCCTGTCCAGCTGATAAAGGACTGGCATGATTTGTCTGTCAGTAACTCCAGGAGAAACTGCCACAGCTGAATTGGTCCGCTTCCTGTGTAGCCAGCTAGAGCAGCAGCAGGGATGACAGGTTTGTCTTTGTTGAGTTCCGCTCTGTCCCTTACATAGTCTTTAAAAGTGCCTTTGGATTTATGGCTCGGCATAGCAGGTGGGTAGTCTTCCGAATCAAAACTGTCATAAGATGGCACACGTTGAAGGCTGTTGTATGAGGACTGGCTGCTCCAAGACTGTGTGAGGCGGTCACAGCTGTCATGGCTCTCAATACTTTCAAAGGACTCCTGCCCACCAAGTTTTCCACGACTGATGCGTCCCAGGCACATGTTGTCTGGAGTCACTACCTCCTGTTTTGATGGTGAAATTAGTCGCCCTGAAAAAAATTCAGGCTGCAAGGGGGTCACGCCACCAGTTCCTAGAAGGGTAATTCATTTCTCATAATTTTCAAAAAAAAAAATTTCCTTCTAAAACTGAAAGGGAAGTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCAGTGTCTGGTTTAACATC