ORFeome > exoc7 ORF1 – XORFeome v1.0

exoc7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: exoc7
Gene ID: 5829110
Gene Page ID: 5829046
ORF Xenbase ID: 17274819

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124870
Original XGC clone length: 2064

Human orthology & disease relationships

NCBI Entrez ID: 23265
Ensembl gene IDs: ENSG00000182473
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 121850,125853,600652,600858,603278,606777

Library Location

Plate ID: GDExl11087
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838061
dbEST ID: 79655763
Trimmed Sequence: ATGATCCCTTCGGAGGACAGCTCCGCCAGGAAGAAAACCATAGAGGAGAAGCTCAAACAGGAAGAGGAAACCCTATCCTTCATCAAGGAGAGCCTGGAGAAGAGCGATCAGCTGACAAACAATATGGTCTCCATCCTGTCCTCTTTTGAGAGCCGGCTAATGAAACTAGAGAATTCCATTATCCCTGTGCACAAACAAACAGAGACCCTGCAGCGCCTGCAGGAAAATGTAGATCGTACCCTGTCCTGCTTGGACCATGTTATCAGCTACTACCATGTTGCCACGGAAACTGAGCGCGTCATCAGAGAAGGACCCTCAGGAAGGCTAGAGGAATACCTGGGCTGCATTGCAAAAATCCAGAAGGCCGTGGAATATTTTCAAGACAATAACCCAGACAGTCCTGAGTTAAACAGAGTGAAGTCCCTGTTTGAGAGGGGAAAGGAGTCTTTGGACACTGAGTTCCGTAGTCTCTTGCAGAGGTACAGCAAACCAGTGCCCCCCATCCTCATTCTAGACCTAATTGGAACTGAGGAGGAGATGGAGAGCCAGGAGGAAACTGTTCTAGAACATCTCCCTGAGGGGATCCTGCANGATGTTATACGCATCTCTAAATGGCTGGTGAAGTATGGGAGGGACCAAGAGTTCATGAATGTCTACTACCAGATCCGCTCTAGCCAGCTGGACCGCTCCATTAAAGGCTTAAGGGATCATCTACGTAAAAACAGCTCCTCCTCTGGCATAACTAACTCTCTGGCTGTCCCAACAAAAGGAAAGAAACCCCCCA
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCCCTTCGGAGGACAGCTCCGCCAGGAAGAAAACCATAGAGGAGAAGCTCAAACAGGAAGAGGAAACCCTATCCTTCATCAAGGAGAGCCTGGAGAAGAGCGATCAGCTGACAAACAATATGGTCTCCATCCTGTCCTCTTTTGAGAGCCGGCTAATGAAACTAGAGAATTCCATTATCCCTGTGCACAAACAAACAGAGACCCTGCAGCGCCTGCAGGAAAATGTAGATCGTACCCTGTCCTGCTTGGACCATGTTATCAGCTACTACCATGTTGCCACGGAAACTGAGCGCGTCATCAGAGAAGGACCCTCAGGAAGGCTAGAGGAATACCTGGGCTGCATTGCAAAAATCCAGAAGGCCGTGGAATATTTTCAAGACAATAACCCAGACAGTCCTGAGTTAAACAGAGTGAAGTCCCTGTTTGAGAGGGGAAAGGAGTCTTTGGACACTGAGTTCCGTAGTCTCTTGCAGAGGTACAGCAAACCAGTGCCCCCCATCCTCATTCTAGACCTAATTGGAACTGAGGAGGAGATGGAGAGCCAGGAGGAAACTGTTCTAGAACATCTCCCTGAGGGGATCCTGCANGATGTTATACGCATCTCTAAATGGCTGGTGAAGTATGGGAGGGACCAAGAGTTCATGAATGTCTACTACCAGATCCGCTCTAGCCAGCTGGACCGCTCCATTAAAGGCTTAAGGGATCATCTACGTAAAAACAGCTCCTCCTCTGGCATAACTAACTCTCTGGCTGTCCCAACAAAAGGAAAGAAACCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCCCTTCGGAGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838060
dbEST ID: 79655762
Trimmed Sequence: TGCAGATGTATCAAACAGCTTCTCGATCATCTCGCCAACCTGATCCACGGAATATTTGATGTACTTCTCTGGGTTCTTGGTAAAGTTTACCCCAGTGCCATATTTTTGCAGAAAGGCTCCGTATGCTTCCAGAACAATGCTCTTCTGTACCTGGCGGATGCGCTCGCGCTGACGCTTGTCAGGAATAGCCCATGATTTCTGGATCTTGCAGAGCTCCTCCAGATTCTCATTGAAACTCTTAAATCGCTCTTTTATTATCTGCCGTTCTTTATCTTTTAACTTGGCCCCTTGTATTACAGGCATATTCCGGTCAGCCAATGATTCTGTCACCTTCAACCAGCTGCGCTGGTATAGCTGTATCTGCTGCTCTATGTGATACCGGTAGGTTTCATCGGGTTCTTTCTGGGTCACAGAAACCAACTGCAGTAGCTCCGACTTCTCCAGAGACTTGAGTATATAGTTGAAATTGTTGTGCAAGAAGATGGCTTTTAAAGCTGGATCTTCATATGTCTTGACCCTGTGTGTAAGCTTCAGCTGTAGGTTCCCCAGAACCTTACAGATATAGGTGCTGAGCAGGCGGCGGTTGAACTCAGAGTTATAACTGCTGGCTGTAGAACTGGTCTCTTGGGAAGCAGCATGGCTCCTGCCGTCTCCTGAAATTCTAGCAGCTGCTGCAAAAACAGGAATGGCGATGCTGGTGATCTCATGAACTGTGCCCTCTTTTTAACCCATTGGTCCTCCTTTTTTTTTCATTCTTGGATACCATTCAAGCAA
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGATGTATCAAACAGCTTCTCGATCATCTCGCCAACCTGATCCACGGAATATTTGATGTACTTCTCTGGGTTCTTGGTAAAGTTTACCCCAGTGCCATATTTTTGCAGAAAGGCTCCGTATGCTTCCAGAACAATGCTCTTCTGTACCTGGCGGATGCGCTCGCGCTGACGCTTGTCAGGAATAGCCCATGATTTCTGGATCTTGCAGAGCTCCTCCAGATTCTCATTGAAACTCTTAAATCGCTCTTTTATTATCTGCCGTTCTTTATCTTTTAACTTGGCCCCTTGTATTACAGGCATATTCCGGTCAGCCAATGATTCTGTCACCTTCAACCAGCTGCGCTGGTATAGCTGTATCTGCTGCTCTATGTGATACCGGTAGGTTTCATCGGGTTCTTTCTGGGTCACAGAAACCAACTGCAGTAGCTCCGACTTCTCCAGAGACTTGAGTATATAGTTGAAATTGTTGTGCAAGAAGATGGCTTTTAAAGCTGGATCTTCATATGTCTTGACCCTGTGTGTAAGCTTCAGCTGTAGGTTCCCCAGAACCTTACAGATATAGGTGCTGAGCAGGCGGCGGTTGAACTCAGAGTTATAACTGCTGGCTGTAGAACTGGTCTCTTGGGAAGCAGCATGGCTCCTGCCGTCTCCTGAAATTCTAGCAGCTGCTGCAAAAACAGGAATGGCGATGCTGGTGATCTCATGAACTGTGCCCTCTTTTTAACCCATTGGTCCTCCTTTTTTTTTCATTCTTGGATACCATTCAAGCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGATGTATCAAACAGCTTC