ORFeome > exog ORF1 – XORFeome v1.0

exog ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: exog
Gene ID: 981842
Gene Page ID: 981838
ORF Xenbase ID: 17274831

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123280
Original XGC clone length: 1077

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ838744
dbEST ID: 79656446
Trimmed Sequence: ATGGTGGCATCTTTCTCCTGGCGGCTCTTGAGCCCGAGATTCCTCGGGGGGTTTGTACTGGGAGCAGCAGCGAGTAGCGCTTCATGTGTGGCCGCTCTGCAGCTGTATGACAAGAGGGAACCCGAGCTGGCTCCTGTAGCTCCGGAAGAGAAGGACCCTTTGGAAGAATATGGCTTTCCGCTCACTGGCACAGAAGCCCGCCAATATATAAACCATGCTTTAGCCTATGACCCTGCAAAGAGAACCCCGAAATGGGTAATTGAACATCTTTCCAGAACCAAAACTGTAGGTAGTGCAGACAGAAAACACTGCAAATTTAAGCCTGATCCCAATATTCCCAAGATGTTCAGTGCTACAAATGAAGACTACCTGGGGAGCGGATGGACAAGGGGTCACATGGCACCAGCAGGAGACAACAAGTTTTCTACAGAGGCGATGGCAGAAACTTTCTATCTGTCCAACATTGTGCCACAGAACTACGAGAATAACGCTGGTTTTTGGAATAGGAAGGAAATGTACTGTAGGGATCTGACAAAGAGAATTGAGGATGTCGGGGTGGTTTCAGGCCCTCTGGAGTTGCCCACGTCCCCTGAAGATGCAAAAAAAAGGGTCACATATTAAGTGATTGGAGCAGATGAAATTGCTGTGGCGTCCCCTTCTATACAAGGTGATCCGGGTAAAGGAGAAAGGGGCCGAACCAGCCCCCTTCCTTTGGGGGGAGTTGTGGGGGCCAAATGTCACCCCTCTTGTTTCAGACTACCAAGCTTCCCGTAACAAAAAAGATTCTAATCTTGAAAGACCCTTGAAGAAAAATGTGCCGG
Full Trace Sequence: CTCGCGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGCATCTTTCTCCTGGCGGCTCTTGAGCCCGAGATTCCTCGGGGGGTTTGTACTGGGAGCAGCAGCGAGTAGCGCTTCATGTGTGGCCGCTCTGCAGCTGTATGACAAGAGGGAACCCGAGCTGGCTCCTGTAGCTCCGGAAGAGAAGGACCCTTTGGAAGAATATGGCTTTCCGCTCACTGGCACAGAAGCCCGCCAATATATAAACCATGCTTTAGCCTATGACCCTGCAAAGAGAACCCCGAAATGGGTAATTGAACATCTTTCCAGAACCAAAACTGTAGGTAGTGCAGACAGAAAACACTGCAAATTTAAGCCTGATCCCAATATTCCCAAGATGTTCAGTGCTACAAATGAAGACTACCTGGGGAGCGGATGGACAAGGGGTCACATGGCACCAGCAGGAGACAACAAGTTTTCTACAGAGGCGATGGCAGAAACTTTCTATCTGTCCAACATTGTGCCACAGAACTACGAGAATAACGCTGGTTTTTGGAATAGGAAGGAAATGTACTGTAGGGATCTGACAAAGAGAATTGAGGATGTCGGGGTGGTTTCAGGCCCTCTGGAGTTGCCCACGTCCCCTGAAGATGCAAAAAAAAGGGTCACATATTAAGTGATTGGAGCAGATGAAATTGCTGTGGCGTCCCCTTCTATACAAGGTGATCCGGGTAAAGGAGAAAGGGGCCGAACCAGCCCCCTTCCTTTGGGGGGAGTTGTGGGGGCCAAATGTCACCCCTCTTGTTTCAGACTACCAAGCTTCCCGTAACAAAAAAGATTCTAATCTTGAAAGACCCTTGAAGAAAAATGTGCCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGCATCTTTCTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838743
dbEST ID: 79656445
Trimmed Sequence: TCCTTTCCTCTCATCACGGTCAGTCCCGCTCTTGAGTGAAAACTCTTTCCTTTTCTTTTCATAAAGGTCCAATAAATAACCATCCGGGGTGATGCCCTCTTCCTTTAATTCAGAGAGGATCCGCTCCAGTTTCTGCAGGTTCCTCGCACCACCCACCCTGCGTGCAGCGATGTACAGTTTAAACTCATGGAGCTGAATGAGTCTGCAGGAATCCACGTCACAGAGGGGCTTCAGGCCTTTGTCCCTGTCCAGTTGAGGGAAGAATAACAAGCCGGACATTTTTTCCAGGTCCTCCAGTTGGACTTTGTATTCAGGGAGCTGGTGATCGAAACCAATGGGAGAATTAGGCACCACAAATGCCCCAATAGCAAGAGGCTGCTCGGAGCCTTTCTCCCTCACCAGGATCACCTTGTATAGATGGGACGGCACAGCAACTTCATCTGCTCCAATCACCTCATATGTGACCCTTTTCTTTCCATCTTCATGGGACGTGGGCAACTCCAGAGGGCCTGAAACCACCCACACATCCTCAAATCTCTTTGTCAGATTCCTACCAGTACATTTCCATCCAATTCCTAAAACCAGCGTTAATTCTCGTAGTTCTGTGGGAACATTGTTGGAACAGAAAAAAGTTTTTGGCCATCGCCTCTGTAAAAAAATTTGTTGGCTCCCTGGCCGGTGCCAGGTGGAGGCCCTGTTTCCCCCCCCCCCCCCCAGGAAACCCTTTATTTTTTAAACACTGAAAAAACTCTTGGGAAAAAAAAGGGGAAATTCGGGC
Full Trace Sequence: GGGAAAAAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCTTTCCTCTCATCACGGTCAGTCCCGCTCTTGAGTGAAAACTCTTTCCTTTTCTTTTCATAAAGGTCCAATAAATAACCATCCGGGGTGATGCCCTCTTCCTTTAATTCAGAGAGGATCCGCTCCAGTTTCTGCAGGTTCCTCGCACCACCCACCCTGCGTGCAGCGATGTACAGTTTAAACTCATGGAGCTGAATGAGTCTGCAGGAATCCACGTCACAGAGGGGCTTCAGGCCTTTGTCCCTGTCCAGTTGAGGGAAGAATAACAAGCCGGACATTTTTTCCAGGTCCTCCAGTTGGACTTTGTATTCAGGGAGCTGGTGATCGAAACCAATGGGAGAATTAGGCACCACAAATGCCCCAATAGCAAGAGGCTGCTCGGAGCCTTTCTCCCTCACCAGGATCACCTTGTATAGATGGGACGGCACAGCAACTTCATCTGCTCCAATCACCTCATATGTGACCCTTTTCTTTCCATCTTCATGGGACGTGGGCAACTCCAGAGGGCCTGAAACCACCCACACATCCTCAAATCTCTTTGTCAGATTCCTACCAGTACATTTCCATCCAATTCCTAAAACCAGCGTTAATTCTCGTAGTTCTGTGGGAACATTGTTGGAACAGAAAAAAGTTTTTGGCCATCGCCTCTGTAAAAAAATTTGTTGGCTCCCTGGCCGGTGCCAGGTGGAGGCCCTGTTTCCCCCCCCCCCCCCCAGGAAACCCTTTATTTTTTAAACACTGAAAAAACTCTTGGGAAAAAAAAGGGGAAATTCGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCTTTCCTCTCATCACGGTCA