ORFeome > exosc8 ORF1 – XORFeome v1.0

exosc8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: exosc8
Gene ID: 961986
Gene Page ID: 961979
ORF Xenbase ID: 17274873

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041271
Original XGC clone length: 831

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ823713
dbEST ID: 79641415
Trimmed Sequence: ATGGCGGCTGGATTCAAGACGGTGGAACCTTTGGAGTATTACAGAAGATTCCTGAAAGAGGCTTGCCGGCCGGATGGACGAGAACTCACCGAGTTTAGAACAACAACCATAAATGTTGGTTCCATTACCACAGCAGACGGTTCAGCTTTAGTGAAGCTTGGGAATTGCACTGTACTGTGTGGTGTGAAAGCGGAGTTAGCAGCTCCTCCAGCAGATTCACCTGATAAAGGATATGTCGTTCCAAATGTGGATCTTACGCCCTTGTGTTCATCACAGTTTCGGCCTGGCCCCCCAGGAGAAGAGGCTCAAGTTGCCAGTCAGTTCATGGCAGATGTCATTGACAATTCCCAGATGCTCCTGAAAGAAGACTTATGCATCGCACATGGCAAGCTAGCATGGGTTCTGTACTGTGATCTCATATGTCTCGATTACGATGGAAATCTTCTTGACACTTGCATGTGTGCATTGGTTGCTGCTTTACAGAATGTAAGGTTGCCATCTGTTAAAATAAATGAAGAGACTGGTTTAGCAGAAGTGAATTTGAAAACAAAGTGTGCCCTGAAAATCCTGAAACACCCGGTAGCTACGTCGTTTGCCCTGTTTGATGACACATCCCTTCTGGTGGATCCCACAGGAGAAGAGGAGAGCTTGGCCAGTGGACTACTCACTGTTGTGACTGATGAAGATGAAAGGTTATGTGCCACTCGA
Full Trace Sequence: CCAGTAATGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGGATTCAAGACGGTGGAACCTTTGGAGTATTACAGAAGATTCCTGAAAGAGGCTTGCCGGCCGGATGGACGAGAACTCACCGAGTTTAGAACAACAACCATAAATGTTGGTTCCATTACCACAGCAGACGGTTCAGCTTTAGTGAAGCTTGGGAATTGCACTGTACTGTGTGGTGTGAAAGCGGAGTTAGCAGCTCCTCCAGCAGATTCACCTGATAAAGGATATGTCGTTCCAAATGTGGATCTTACGCCCTTGTGTTCATCACAGTTTCGGCCTGGCCCCCCAGGAGAAGAGGCTCAAGTTGCCAGTCAGTTCATGGCAGATGTCATTGACAATTCCCAGATGCTCCTGAAAGAAGACTTATGCATCGCACATGGCAAGCTAGCATGGGTTCTGTACTGTGATCTCATATGTCTCGATTACGATGGAAATCTTCTTGACACTTGCATGTGTGCATTGGTTGCTGCTTTACAGAATGTAAGGTTGCCATCTGTTAAAATAAATGAAGAGACTGGTTTAGCAGAAGTGAATTTGAAAACAAAGTGTGCCCTGAAAATCCTGAAACACCCGGTAGCTACGTCGTTTGCCCTGTTTGATGACACATCCCTTCTGGTGGATCCCACAGGAGAAGAGGAGAGCTTGGCCAGTGGACTACTCACTGTTGTGACTGATGAAGATGAAAGGTTATGTGCCACTCGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGGATTCAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829023
dbEST ID: 79646725
Trimmed Sequence: GGGACAACTTTGTACAAGAAAGTTGGCAATTCTGACTTGACACTGGCCAGTGCCTCTTGCAGAAGGTTTGTCACTTCTTTGTGTCTGGTGATGGCCCGACTGATACACTCCTGAAGCTTCTCTGCCGAAAGTGCACTCCCACCTGGTTTTCGAGTGGCACATAACCTTTCATCTTCATCAGTCACAACAGTGAGTAGTCCACTGGCCAAGCTCTCCTCTTCTCCTGTGGGATCCACCAGAAGGGATGTGTCATCAAACAGGGCAAACGACGTAGCTACCGGGTGTTTCAGGATTTTCAGGGCACACTTTGTTTTCAAATTCACTTCTGCTAAACCAGTCTCTTCATTTATTTTAACAGATGGCAACCTTACATTCTGTAAAGCAGCAACCAATGCACACATGCAAGTGTCAAGAAGATTTCCATCGTAATCGAGACATATGAGATCACAGTACAGAACCCATGCTAGCTTGCCATGTGCGATGCATAAGTCTTCTTTCAGGAGCATCTGGGAATTGTCAATGACATCTGCCATGAACTGACTGGCAACTTGAGCCTCTTCTCCTGGGGGGCCAGGCCGAAACTGTGATGAACACAAGGGCGTAAGATCCACATTTGGAACGACATATCCCTTATCAGGTGAATCTGCTGGAGGAGCTGCTAACTCCGCTTTCACACCACACAGTACAGTGCAAATCCCCAAGCTTTCACTAAAGCTGAAACGTTCCTGCTGGTGGTAAATGGAACCCAAACATTTTAAGGGGTTTT
Full Trace Sequence: GGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGACTTGACACTGGCCAGTGCCTCTTGCAGAAGGTTTGTCACTTCTTTGTGTCTGGTGATGGCCCGACTGATACACTCCTGAAGCTTCTCTGCCGAAAGTGCACTCCCACCTGGTTTTCGAGTGGCACATAACCTTTCATCTTCATCAGTCACAACAGTGAGTAGTCCACTGGCCAAGCTCTCCTCTTCTCCTGTGGGATCCACCAGAAGGGATGTGTCATCAAACAGGGCAAACGACGTAGCTACCGGGTGTTTCAGGATTTTCAGGGCACACTTTGTTTTCAAATTCACTTCTGCTAAACCAGTCTCTTCATTTATTTTAACAGATGGCAACCTTACATTCTGTAAAGCAGCAACCAATGCACACATGCAAGTGTCAAGAAGATTTCCATCGTAATCGAGACATATGAGATCACAGTACAGAACCCATGCTAGCTTGCCATGTGCGATGCATAAGTCTTCTTTCAGGAGCATCTGGGAATTGTCAATGACATCTGCCATGAACTGACTGGCAACTTGAGCCTCTTCTCCTGGGGGGCCAGGCCGAAACTGTGATGAACACAAGGGCGTAAGATCCACATTTGGAACGACATATCCCTTATCAGGTGAATCTGCTGGAGGAGCTGCTAACTCCGCTTTCACACCACACAGTACAGTGCAAATCCCCAAGCTTTCACTAAAGCTGAAACGTTCCTGCTGGTGGTAAATGGAACCCAAACATTTTAAGGGGTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGACTTGACACTGGC