ORFeome > ext2 ORF1 – XORFeome v1.0

ext2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ext2
Gene ID: 6254068
Gene Page ID: 867541
ORF Xenbase ID: 17274903

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044703
Original XGC clone length: 2157

Human orthology & disease relationships

NCBI Entrez ID: 2132
Ensembl gene IDs: ENSG00000151348,LRG_494
Directly associated (OMIM) disease MIM numbers: 133701
Indirectly associated (Lage, et al.) disease MIM numbers: 133700,133701,150230,215300,601224

Library Location

Plate ID: GDExl11016
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ824296
dbEST ID: 79641998
Trimmed Sequence: 0
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACTCGTACTACTGGGCCATATGTGTATCCTGGCTTTTCTGGACGGCGTCTTTGTTCTCTGATGTGGCACCATGTGTGCCTCGGTCAAGTACAGCACAAGGGGTCCAGTCCTGATCCCCAGGATGAAGTCCAAGCACCGCGTTTACTACATCGCCCTCTTCTCTGTGGTGCTGCTGGGACTTATTGCCACGGGCATGTTTCAGTTCTGGCCGCACACTATCGAGACTTCCAGTGATTGGACGGTGGATAAGAGAAGCGTTCATGACGTGCCATTGGTCAGACTCTCGTCGGACTGTCCAATCCCAGAGAGGGGAGACTTAAGCTGCAGGATGCACACCTGCTTTGACGTATATCGCTGCGGATACAACCCCAAGAACAAGGTGAAGGTGTACATCTACCCGCTGCAGAAATACACAGACGAGTACAGCGTGACGGTGGGGGGCACCATCTCCCGGGAGTACAACCAGCTTCTCAGTGCCGTCTCCCAGAGCGACTTCTACACCGAAGATGTGAGCAGGGCCTGTCTCTTTCTGCCCTCCATCGATGTTCTCAACCAAGACAGTCTGCGTATTAAAGAGACGGCACAAGCGATGGCACAGCTAACCAGATGGGACCGAGGTACCAACCACCTACTATTTAACATGCTTCCTGGTGGACCCCCAGATTATAACACTGCTCTTGATGTCCCCCGAGACAGAGCCTTGTTGGCCGGAGGAGGATTTTCGACGTGGACCTACCGGCAGGGTTATGACGTCAGTATCCCAGTGTACAGCTCCCTGTCTGCAGAGGTGAACCTACCTGAGAAAGCCCCTGGCACCCGAACCCCACTTCCNTCCTGTCCCTCCCAGACTTCTTTTGCACCCAGGAATTCCGCCTCCAAAACCTGGGAAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGCCTCGGTCAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829639
dbEST ID: 79647341
Trimmed Sequence: CAGGCTGCCGATGTTGGGGAAACTCTTCAGCTTCTCTGGGAAGTCGTCCTTGTACAGCACGGGGTCAGCACGGTGCTCCACCACCTTCAGGGGCATGGTGCCGAAAACCGACGCAAACTTGTTGATACATTCAGATCTCTCCACCATGTGCGTCTGATCCAGTGACAGCCCATCGATGGCCGTGCATTCTGGGCACTTGAACTTCTTTCTCGGAGTCACCTTAATAGGTGCCTTGCCTGTCACGTTGGCCACTAAGAAGTTCATGGCGATATCTTCGCAGTTCATGTGGGCGTCGACCCAGTTCTTGATGTCCCCGGGCATCTTGTAGGTGTACAGGTAGTTGAAGTACTTGTGGTAGAAAGCTGCACCCGTCAGAACCATCGACACCTCGTTTGTCCACTCGGATTCATATTTCCACTTGCTCATTTCATGATCCCACAGGTGCAGCCGGCCCGGGTATCCCACCAACCTGTCTGGAAACTCCCGCCATACCTCGTAACCAAACTGAAGCTCATCTGATGTCAGCATGATGATGTCATCGTCAATAGCCAGAACGGCTTCTGTCTCAATTTCACTGTAAGGGGAAGAAGCGGTTGCTCAGCTTGTTCTCAGTGGTCCTCACGACTTTCAATGGAACCCGGATCTTTGGCCAACAGAAGCTTTCGGGGAGGGGTTTTTATTCTGATTAATTCCACCCCACTATGCACCCTGGGACCGGACTTGGGGAACTTTGTGGAAAATTTTGGGGTGAAAGAAACCCG
Full Trace Sequence: ACGTGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAGATAGTGATTTTATTTTAGACGGATAGTGACCTGTTCGTTGCGCAAGGGGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGCTGCCGATGTTGGGGAAACTCTTCAGCTTCTCTGGGAAGTCGTCCTTGTACAGCACGGGGTCAGCACGGTGCTCCACCACCTTCAGGGGCATGGTGCCGAAAACCGACGCAAACTTGTTGATACATTCAGATCTCTCCACCATGTGCGTCTGATCCAGTGACAGCCCATCGATGGCCGTGCATTCTGGGCACTTGAACTTCTTTCTCGGAGTCACCTTAATAGGTGCCTTGCCTGTCACGTTGGCCACTAAGAAGTTCATGGCGATATCTTCGCAGTTCATGTGGGCGTCGACCCAGTTCTTGATGTCCCCGGGCATCTTGTAGGTGTACAGGTAGTTGAAGTACTTGTGGTAGAAAGCTGCACCCGTCAGAACCATCGACACCTCGTTTGTCCACTCGGATTCATATTTCCACTTGCTCATTTCATGATCCCACAGGTGCAGCCGGCCCGGGTATCCCACCAACCTGTCTGGAAACTCCCGCCATACCTCGTAACCAAACTGAAGCTCATCTGATGTCAGCATGATGATGTCATCGTCAATAGCCAGAACGGCTTCTGTCTCAATTTCACTGTAAGGGGAAGAAGCGGTTGCTCAGCTTGTTCTCAGTGGTCCTCACGACTTTCAATGGAACCCGGATCTTTGGCCAACAGAAGCTTTCGGGGAGGGGTTTTTATTCTGATTAATTCCACCCCACTATGCACCCTGGGACCGGACTTGGGGAACTTTGTGGAAAATTTTGGGGTGAAAGAAACCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCTGCCGATGTTGGGGA