ORFeome > f8a1 ORF1 – XORFeome v1.0

f8a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: f8a1
Gene ID: 5866660
Gene Page ID: 5866628
ORF Xenbase ID: 17274963

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC125991
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ838765
dbEST ID: 79656467
Trimmed Sequence: ATGGCGACAGATGGGGACTTCTTGCTGCGCTACAGAGCTGTCTCTAACAAGCTTAAGAAGAGATTTTTACGGAAGCCAAATGTTTCTGAGGCTAGTGAGCAGTTTGGTCAGTTGGCTAAAGAACTCAAGCAACAAGACTGCCTTCAATATGCTGGTTTCTGTAACTTAGCTATGGCTAGATGTGAGCAGACGCTGTTTAATGCTCCAGGAGAGGCCATGGCATTAACAGAAGCTGCACGTCTTTTTTTGCAAGAAGAAAAGGAAACTCAGCGCTTGAAGTGTCCAGGGTTTGAGGAACATCTGCAGGCTGCCATTAACTGCTACAGCTTTGCCATAAAAGTTTACATTGAACTCAACCAGCCAGTGATGGCAGCCAGCCTTTGCCTGGAACTAGGAAATGCTCTGAAGGATATGAGTAAACTGGGAGAAGCCATGGTGTATTTCCAGCGTGCAGCAGAGTTGCAAACACAAGTTCCTATTGAGTGCCTGCTTTCACTTGGATATGTAGCTTCCTGTAAGATCATGACACGTGACTATGATGGAGCTTTGGCTGTATTCACAGAGATGCAACTGCTGGCCCAGGAAAAGGGACTGCACACCCCTGGGAAAGTCTACCAGTTGGAACATTTCTGGGACTCCTAGCAAAGTGTGAAGTATCAAAGGTCCTTCTGGTTTAGTTTGTTACACCCCCCCCCTTCAAAAGCTGCGGGCCGGAACATGCTAAAACTTTTGGGAAAAAAATGAATGGGGAAACCATTTAAAAATCTCACACCCCGGGGGGAAGTTTTTTGAACAGAAGAAAAGGGGTTTTTTTTCAGGGCTTGC
Full Trace Sequence: TCGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGACAGATGGGGACTTCTTGCTGCGCTACAGAGCTGTCTCTAACAAGCTTAAGAAGAGATTTTTACGGAAGCCAAATGTTTCTGAGGCTAGTGAGCAGTTTGGTCAGTTGGCTAAAGAACTCAAGCAACAAGACTGCCTTCAATATGCTGGTTTCTGTAACTTAGCTATGGCTAGATGTGAGCAGACGCTGTTTAATGCTCCAGGAGAGGCCATGGCATTAACAGAAGCTGCACGTCTTTTTTTGCAAGAAGAAAAGGAAACTCAGCGCTTGAAGTGTCCAGGGTTTGAGGAACATCTGCAGGCTGCCATTAACTGCTACAGCTTTGCCATAAAAGTTTACATTGAACTCAACCAGCCAGTGATGGCAGCCAGCCTTTGCCTGGAACTAGGAAATGCTCTGAAGGATATGAGTAAACTGGGAGAAGCCATGGTGTATTTCCAGCGTGCAGCAGAGTTGCAAACACAAGTTCCTATTGAGTGCCTGCTTTCACTTGGATATGTAGCTTCCTGTAAGATCATGACACGTGACTATGATGGAGCTTTGGCTGTATTCACAGAGATGCAACTGCTGGCCCAGGAAAAGGGACTGCACACCCCTGGGAAAGTCTACCAGTTGGAACATTTCTGGGACTCCTAGCAAAGTGTGAAGTATCAAAGGTCCTTCTGGTTTAGTTTGTTACACCCCCCCCCTTCAAAAGCTGCGGGCCGGAACATGCTAAAACTTTTGGGAAAAAAATGAATGGGGAAACCATTTAAAAATCTCACACCCCGGGGGGAAGTTTTTTGAACAGAAGAAAAGGGGTTTTTTTTCAGGGCTTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACAGATGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838764
dbEST ID: 79656466
Trimmed Sequence: GATGCCTTGACCTGATGGGCAAATCATCTCTTGCAGAACCAAATGCAGTAAGTGATTCTGTTCAGGTGTTAAGAGCGGCCATAACTCTACCTGCAGAACTTTTAGGGATTCCACATCATTTTCTTGGCAGGCCATGACTACTGACTGCAGCAGTAAAAACACTTCTTCTGTCAAATAATTCACATGGCTGTGACTATCAAATGCTTCCCAGTCATATTTTTCAAGAGTTTGAGCATGTTCAGGCAGCAGCTTCTGAGGTGGAGGCTGTAACAACATAAGCAGAAGGACCCTTGATACTTCACACTTTGCTATGATGTCCAGAAATGCTCCAACTGGTAGACTGTTCCCAGGGGTGTGCAGTCCCTTTTCCTGGGCCAGCAGTTGCATCTCTGTGAATACAGCCAAAGCTCCATCATAGTCACGTGTCATGATCTTACAGGAAGCTACATATCCAAGTGAAAGCAGGCACTCAATAGGAACTTGTGTTTGCAACTCTGCTGCACGCTGGAAATACACCATGGCTTCTCCCAGTTTACTCATATCCTTCAGAGCATTTCCTAGTTCCAGGCAAAGGCTGGCTGCCATCACTGGCTGGTTGAGTTCCATGTAAACTTTTATGGCAAAGCTGTAGCAGTTAATGGCAGCCTGCAAATGTTCCTCAAACCCGGGACACTTTCAACCCTTAGTTTCCTTTTTCCTCTTTGCAAAAAAAAACTTGCCACCCTTCGGTTAATGCCCTTGGCCCCCCTCCCGGGAACCATTTAAACAACCGTTCC
Full Trace Sequence: AAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGCCTTGACCTGATGGGCAAATCATCTCTTGCAGAACCAAATGCAGTAAGTGATTCTGTTCAGGTGTTAAGAGCGGCCATAACTCTACCTGCAGAACTTTTAGGGATTCCACATCATTTTCTTGGCAGGCCATGACTACTGACTGCAGCAGTAAAAACACTTCTTCTGTCAAATAATTCACATGGCTGTGACTATCAAATGCTTCCCAGTCATATTTTTCAAGAGTTTGAGCATGTTCAGGCAGCAGCTTCTGAGGTGGAGGCTGTAACAACATAAGCAGAAGGACCCTTGATACTTCACACTTTGCTATGATGTCCAGAAATGCTCCAACTGGTAGACTGTTCCCAGGGGTGTGCAGTCCCTTTTCCTGGGCCAGCAGTTGCATCTCTGTGAATACAGCCAAAGCTCCATCATAGTCACGTGTCATGATCTTACAGGAAGCTACATATCCAAGTGAAAGCAGGCACTCAATAGGAACTTGTGTTTGCAACTCTGCTGCACGCTGGAAATACACCATGGCTTCTCCCAGTTTACTCATATCCTTCAGAGCATTTCCTAGTTCCAGGCAAAGGCTGGCTGCCATCACTGGCTGGTTGAGTTCCATGTAAACTTTTATGGCAAAGCTGTAGCAGTTAATGGCAGCCTGCAAATGTTCCTCAAACCCGGGACACTTTCAACCCTTAGTTTCCTTTTTCCTCTTTGCAAAAAAAAACTTGCCACCCTTCGGTTAATGCCCTTGGCCCCCCTCCCGGGAACCATTTAAACAACCGTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGCCTTGACCTGATGGGCAAA