ORFeome > fabp3 ORF1 – XORFeome v1.0

fabp3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fabp3
Gene ID: 974430
Gene Page ID: 974422
ORF Xenbase ID: 17274981

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056855
Original XGC clone length: 396

Human orthology & disease relationships

NCBI Entrez ID: 2170
Ensembl gene IDs: ENSG00000121769
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ839393
dbEST ID: 79657095
Trimmed Sequence: ATGGAGAAATTTGCAGGAACCTGGCGGCTAGTGGACAGCAAGAATTTTGATGAATACATGAAAGCTCTTGGAGTAGGATTTGCTACCAGACAAATTGGAAACGTTACCAAACCTACAACTATAATAAGCGTGGATGGGGACAAAATCGTACTGCAGACGCAAAGTACCTTCAAAAACACAGAGGTCAGCTTTAAACTCAATGAGGAATTTGATGAGATCACTGCAGATGATCGGAAATGCAAGTCACTGGTAACTCTAGAAGACGGGAAATTGAAACATGTGCAGAAGTGGGATGGTAAAGAGACCATCTTAATAAGGGAGGTTGATGGAGACAAACTAGTACTGAATTTAACCTTTGGAGATGTGGCCAGCTCACGTCACTACAAAAGAGCCTT
Full Trace Sequence: CTCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAAATTTGCAGGAACCTGGCGGCTAGTGGACAGCAAGAATTTTGATGAATACATGAAAGCTCTTGGAGTAGGATTTGCTACCAGACAAATTGGAAACGTTACCAAACCTACAACTATAATAAGCGTGGATGGGGACAAAATCGTACTGCAGACGCAAAGTACCTTCAAAAACACAGAGGTCAGCTTTAAACTCAATGAGGAATTTGATGAGATCACTGCAGATGATCGGAAATGCAAGTCACTGGTAACTCTAGAAGACGGGAAATTGAAACATGTGCAGAAGTGGGATGGTAAAGAGACCATCTTAATAAGGGAGGTTGATGGAGACAAACTAGTACTGAATTTAACCTTTGGAGATGTGGCCAGCTCACGTCACTACAAAAGAGCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCACCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTAAAAGAAATGTATCAAATCTTATAATGTAAAAGGAAAACAGCCAGGGATAAATAGCCCAAACTCCCCGTCGAAAAAAAAAAAAAAAATCTTACAGGGAAACTGGAAAAGGGGCCCCCCGTGGAAACAAACCCGGGGGGAGGGGATGGTTTTTTGTGATTCCCGCCCGGAAGGGGGGTGGGGGAGGAACCTTAAAAAAAAGAGTGGGGGGGGAGGGGCGGGAGGGGGGGGGTTTATGGGGGGGGGAGAGATAAACGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAAATTTGCAGGAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839392
dbEST ID: 79657094
Trimmed Sequence: GGCTCTCTCGTAGTGACGTGAGCTGGCCACATCTCCAAAGGTTAAATTCAGTACTATTTTGTCTCCATCAACCTCCCTTATTAAAATGGTCTCTTTACCATCCCACTTCTGCACATGTTTCAATTTCCCGTCTTCTAGAGTTACCAGTGACTTGCATTTCCAATCATCTGCAGTGATCTCATCAAATTCCTCATTGAGTTTAAAGCTGACCTCTGTGTTTTTGAAGGTACTTTGCGTCTGCAGTACGATTTTGTCCCCATCCACGCTTATTATATTTGTAGGTTTGGTAACGTTTCCAATTTGTCTGGTACCAAATCCTACTCCAAGAGCTTTCATGTATTCATCAAAATTCTTGCTGTCCACTAGCCGCCAGGTTCCTGCAAATTTCTCCATGG
Full Trace Sequence: GGGAAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCTCTCTCGTAGTGACGTGAGCTGGCCACATCTCCAAAGGTTAAATTCAGTACTATTTTGTCTCCATCAACCTCCCTTATTAAAATGGTCTCTTTACCATCCCACTTCTGCACATGTTTCAATTTCCCGTCTTCTAGAGTTACCAGTGACTTGCATTTCCAATCATCTGCAGTGATCTCATCAAATTCCTCATTGAGTTTAAAGCTGACCTCTGTGTTTTTGAAGGTACTTTGCGTCTGCAGTACGATTTTGTCCCCATCCACGCTTATTATATTTGTAGGTTTGGTAACGTTTCCAATTTGTCTGGTACCAAATCCTACTCCAAGAGCTTTCATGTATTCATCAAAATTCTTGCTGTCCACTAGCCGCCAGGTTCCTGCAAATTTCTCCATGGTGCCAACTTTTTTGTACAAATTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCTTTATTTGGGGCCCAAAAAAAAAAAAGAACCGTCATTTATACAGGGGTCAACTGAGCCGTCGGGAAAAAACTACCAACATTCTCAAACAAATGTGCGGTGGCAAAACTAAAGTTTAAGGGGAGGAGCCCCACCCGGGAAAAACCACCTGGGCCGGTGTCAGAATTGAAGAACAACGGCGCGGGGCGGGGCGCCAACAGTTTGCACATACCCGGTGTGGACGGGGGTGGGGGGGGTGGGGGTGTTTAAGCGGTGTTTTTTTGGGGGAACAAAACCTCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTCTCTCGTAGTGAC