ORFeome > faf1-prov ORF1 – XORFeome v1.0

faf1-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256614
Gene Page ID:
ORF Xenbase ID: 17275011

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045062
Original XGC clone length: 1974

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ823893
dbEST ID: 79641595
Trimmed Sequence: ATGGCCTCCAACACGGACAGGGAGATGGTTCTGGCCGACTTCCAGGCATGTACAGGCATTGAAAATATTGATGAAGCTATAACATTGCTAGAACAAAACAACTGGGATTTAGTAGCTGCAATAAATGGTGTTATACCACAGGAAAATGGTATATTGCAGAGTGAATACAGCAGTGATTCCTTGCCAAACCAGGTATCTAGTACTGCTGCCCAAACAGCTACCACGGCTGCTGCTTCTTCTTCTTCCCTGCCTTCATCCTCCACGTCAGCTTTTCGTCCTGTGGTTCCGTCACGGCAGATTGTTGAGCGGCTGTCACGAATGCTAAACTTTAAAGTTGAGTACAGAGACAAAACAGCAGATGTAGTTCTAGAAGACAGCTGCACTGTAGGAGACATCAAACAGATCCTAGAGAATGAACTTCAAATCCCTGTTTCTAAAATGCTGTTAAAGGGTTGGAAATCTGGTGATGTGGAAGACAGTACTGTTTTGAGAAACCTTCGCTTGCCAAAAAATAATAACCTTTATGTCCTCACCCCCGAGTTACAACCTCCTTCTCATTCAAGCCAGTCTAGTGCTCAGCAGGAGTCATTAAATAAGAACTATTTGCTGATCATCACACACCGTGAAGTCCAGAGGGAGTACAGCTTGCACTTCTCCGGGAGCTGTACTATTCANGAGGTAAAAAGAAATGTATATGATCTCACCAGCATACCAGTACGTCACCAGTTTGTGGGGAAGGGTGGGCCCCAATCTGCACAAGAGAAATTCAATAATGGTTGGCATCCTTCAGAAGTGAACTAAACATTTCTCCCCCCTCCCCATGGTCAGGAAAAAAAATCCCCGCTTCTCAAACAAAAAAACAT
Full Trace Sequence: TAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTCCAACACGGACAGGGAGATGGTTCTGGCCGACTTCCAGGCATGTACAGGCATTGAAAATATTGATGAAGCTATAACATTGCTAGAACAAAACAACTGGGATTTAGTAGCTGCAATAAATGGTGTTATACCACAGGAAAATGGTATATTGCAGAGTGAATACAGCAGTGATTCCTTGCCAAACCAGGTATCTAGTACTGCTGCCCAAACAGCTACCACGGCTGCTGCTTCTTCTTCTTCCCTGCCTTCATCCTCCACGTCAGCTTTTCGTCCTGTGGTTCCGTCACGGCAGATTGTTGAGCGGCTGTCACGAATGCTAAACTTTAAAGTTGAGTACAGAGACAAAACAGCAGATGTAGTTCTAGAAGACAGCTGCACTGTAGGAGACATCAAACAGATCCTAGAGAATGAACTTCAAATCCCTGTTTCTAAAATGCTGTTAAAGGGTTGGAAATCTGGTGATGTGGAAGACAGTACTGTTTTGAGAAACCTTCGCTTGCCAAAAAATAATAACCTTTATGTCCTCACCCCCGAGTTACAACCTCCTTCTCATTCAAGCCAGTCTAGTGCTCAGCAGGAGTCATTAAATAAGAACTATTTGCTGATCATCACACACCGTGAAGTCCAGAGGGAGTACAGCTTGCACTTCTCCGGGAGCTGTACTATTCANGAGGTAAAAAGAAATGTATATGATCTCACCAGCATACCAGTACGTCACCAGTTTGTGGGGAAGGGTGGGCCCCAATCTGCACAAGAGAAATTCAATAATGGTTGGCATCCTTCAGAAGTGAACTAAACATTTCTCCCCCCTCCCCATGGTCAGGAAAAAAAATCCCCGCTTCTCAAACAAAAAAACAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTCCAACACGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829202
dbEST ID: 79646904
Trimmed Sequence: TTCCTTAGCTTCCAGAAAAAGTGTTTCCTGAGGATACAGCTTAAGATCTAGGAGTGATCTGTTAGGGTCCAATTGTGTTATATCTCTCCTAGGAAATGTGCTGAGAAGCTTGAACTCATGGCAGGGATACCCTTTGGATGCTACAAAGTCAAGGACAACTTGCAGAGGGCTAGATCCCAGGAAGCGCCTCTCAAGGAACTTCCCACTTGGGGTTCTGATACGGAGCTTGCTTAATGGTTCACTTTCTTCCAGTGGTTCTGGAGGCAAAGCCTGTTCCAAAGAAAGCCGAATTGCCTCTCTCTCTTCCTCCTGTTCTTTTCGGATTTGTTCCAAACGGTATTGTTCAGCAATTTCTCTCTCCTGAGCTTCTCTTTTTGCTCGGTCGGCTTCTAAAGATAAACGATAAGCTTCATCCTGCTCTCGCTTCACATTTTCTCGTGCTTCCCGTTCATCTTCATCCTTTATGTCTTCCTGCTGTTGTGCAGTAAACATTTCCATTGCCGAGATAAGTCTCATCATTAGTTCATCCACTGATGTATTCCCTTGAATGACATTCAGTACTTCATTAGATGATCGTTTGCCCATTATAATGAGGGAAAGTGGAAACTGATCTGTGGTTTGTGCACGAACAGTCTGTGCTACCACACTTCCCAAATGTTCGGGTGCAAAGGGTCAGAAATCTGGCTCTGTTTAGCTTCTTTTGTCAAATCCCCGGGCCC
Full Trace Sequence: GGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTTAGCTTCCAGAAAAAGTGTTTCCTGAGGATACAGCTTAAGATCTAGGAGTGATCTGTTAGGGTCCAATTGTGTTATATCTCTCCTAGGAAATGTGCTGAGAAGCTTGAACTCATGGCAGGGATACCCTTTGGATGCTACAAAGTCAAGGACAACTTGCAGAGGGCTAGATCCCAGGAAGCGCCTCTCAAGGAACTTCCCACTTGGGGTTCTGATACGGAGCTTGCTTAATGGTTCACTTTCTTCCAGTGGTTCTGGAGGCAAAGCCTGTTCCAAAGAAAGCCGAATTGCCTCTCTCTCTTCCTCCTGTTCTTTTCGGATTTGTTCCAAACGGTATTGTTCAGCAATTTCTCTCTCCTGAGCTTCTCTTTTTGCTCGGTCGGCTTCTAAAGATAAACGATAAGCTTCATCCTGCTCTCGCTTCACATTTTCTCGTGCTTCCCGTTCATCTTCATCCTTTATGTCTTCCTGCTGTTGTGCAGTAAACATTTCCATTGCCGAGATAAGTCTCATCATTAGTTCATCCACTGATGTATTCCCTTGAATGACATTCAGTACTTCATTAGATGATCGTTTGCCCATTATAATGAGGGAAAGTGGAAACTGATCTGTGGTTTGTGCACGAACAGTCTGTGCTACCACACTTCCCAAATGTTCGGGTGCAAAGGGTCAGAAATCTGGCTCTGTTTAGCTTCTTTTGTCAAATCCCCGGGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTAGCTTCCAGAAAAAGTGT