ORFeome > fah ORF1 – XORFeome v1.0

fah ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: fah
Gene ID: 964395
Gene Page ID: 964391
ORF Xenbase ID: 17275029

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054283
Original XGC clone length: 1263

Human orthology & disease relationships

NCBI Entrez ID: 2184
Ensembl gene IDs: ENSG00000103876
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 203500,231900,266130

Library Location

Plate ID: GDExl11002
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ839303
dbEST ID: 79657005
Trimmed Sequence: ATGTCCTTCATTCAAGTGGAAGCAAATTCCGATTTTCCCATTCAGAACCTCCCGTACGGAGTGTTCTCAACACACGATGAGCCCAGACATCGGATAGGGGTTGCGATTGGTGACCAAATCTTAGATCTAAGTGTTATCAGACATTTATTTACTGGACCTTTTGTGTCGGGGAATCAAGATGTTTTTAACCAGCCAATCCTCAATAGCTTTATGGCCCTGGGGCACAATGCATGGCGAGAGGTGAGACAGTTTCTCCAGCAGCTGCTATCAGCATCAGAACCTTTGCTAAGGGACAACATGGAGCTGCGATCCAGGGCATTTGTGCCACAAGCTAAGGCAACCCTTCATCTTCCAGCAAATATTGGGGATTACACTGACTTCTACTCCTCCAGAGATCATGCTACTAATGTAGGCATTATGTTCAGAGGGAAGGACAATGCTCTGATGCCAAACTGGCTTCACCTTCCAGTGGGATATCATGGCCGTGCATCCTCTGTGGTTGTATCAGGAACTCCAGTGCGTAGGCCAATGGGCCAGGTTCGACCAAATGATGACAAGCCTCCAGAATTTGAGGCCAGCAAGCTTCTGGACATTGAATTGGAAATGGCTTTCTTTGTGGGTTCAGGAAACTCGTTGGGAACCCCCATTCCCATTCATAAAGCTGAGGAGCACATCTTTCGGGATGGTACTGATGAATGACTGGAGTGCCAGAAACATCCAAAAATGGGAAATATGTTCCACTCGGGGCCTTTTCTAAATTAAGAAATTTTGCAAACCACCATTTTCTCCCCCTGGGGGTTGGAACCCGATTGA
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCATTCAAGTGGAAGCAAATTCCGATTTTCCCATTCAGAACCTCCCGTACGGAGTGTTCTCAACACACGATGAGCCCAGACATCGGATAGGGGTTGCGATTGGTGACCAAATCTTAGATCTAAGTGTTATCAGACATTTATTTACTGGACCTTTTGTGTCGGGGAATCAAGATGTTTTTAACCAGCCAATCCTCAATAGCTTTATGGCCCTGGGGCACAATGCATGGCGAGAGGTGAGACAGTTTCTCCAGCAGCTGCTATCAGCATCAGAACCTTTGCTAAGGGACAACATGGAGCTGCGATCCAGGGCATTTGTGCCACAAGCTAAGGCAACCCTTCATCTTCCAGCAAATATTGGGGATTACACTGACTTCTACTCCTCCAGAGATCATGCTACTAATGTAGGCATTATGTTCAGAGGGAAGGACAATGCTCTGATGCCAAACTGGCTTCACCTTCCAGTGGGATATCATGGCCGTGCATCCTCTGTGGTTGTATCAGGAACTCCAGTGCGTAGGCCAATGGGCCAGGTTCGACCAAATGATGACAAGCCTCCAGAATTTGAGGCCAGCAAGCTTCTGGACATTGAATTGGAAATGGCTTTCTTTGTGGGTTCAGGAAACTCGTTGGGAACCCCCATTCCCATTCATAAAGCTGAGGAGCACATCTTTCGGGATGGTACTGATGAATGACTGGAGTGCCAGAAACATCCAAAAATGGGAAATATGTTCCACTCGGGGCCTTTTCTAAATTAAGAAATTTTGCAAACCACCATTTTCTCCCCCTGGGGGTTGGAACCCGATTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCATTCAAGTGGAAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839302
dbEST ID: 79657004
Trimmed Sequence: ATCAGAGAGGGGAAGAGCAGGGAGGACTGTCCCGGAGCAAGTCCCAAATCCAACACGATAACCCTCTCCTTGGCAGTAACCTGCTATAGTCACAGTGTCCCCATCTTGCAGGAATGTCCTCTTGTGTCCATCTCCGAGATCTACAGGTTTGCTTCCTCTCCAGGACAGTTCCAGCATTGAGCCAAAGCTTCCAGGGTCCGGCCCACTTATGGTCCCGGACGCTAGGAGGTCTCCAGGTCGTACGTTGCACCCAGTAACTGTGTGGTGAGCCAGCTGCTGCTTCATTGTCCAGTACATGTACTTATAGTTAGATTTACATATAGAAACTGGATTCTTCATTCCTTTCCCTTGAATGCAGACGCACAGGTTGATATCAAACCTGTAATTGGTGTTATCACGAAGGTAGGGCAGTGGCACAGGATCCTGCACTGGATTTGGCAGAACAAATGGCATAAGGGCTTCCATCGGTACAACCCAGGGAGAGATGGTGGTTGCAAAATTCTTACTTAGAAATGGCCCGAGTGGAACATATTCCCACTTTTGGATGTCTCTGGCACTCCAGTCATTCATCAGTACCATCCCGAAGATGTGCTCCTCAGCTTTATGAATTGGGATGGGGGGGTTCCCAACGAGTTTTCCTGAACCCCACAAGAAAAGCCATTTTCAATTCAATGGTCAAAAAGCTTTGCTGGCCTCAAATTCTTGGAAGCCTGGTCCATCCATTTGGGTCCAAACCCTGGGCCCAATTGGCCCCTATACCCACCTGGGAAAT
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCAGAGAGGGGAAGAGCAGGGAGGACTGTCCCGGAGCAAGTCCCAAATCCAACACGATAACCCTCTCCTTGGCAGTAACCTGCTATAGTCACAGTGTCCCCATCTTGCAGGAATGTCCTCTTGTGTCCATCTCCGAGATCTACAGGTTTGCTTCCTCTCCAGGACAGTTCCAGCATTGAGCCAAAGCTTCCAGGGTCCGGCCCACTTATGGTCCCGGACGCTAGGAGGTCTCCAGGTCGTACGTTGCACCCAGTAACTGTGTGGTGAGCCAGCTGCTGCTTCATTGTCCAGTACATGTACTTATAGTTAGATTTACATATAGAAACTGGATTCTTCATTCCTTTCCCTTGAATGCAGACGCACAGGTTGATATCAAACCTGTAATTGGTGTTATCACGAAGGTAGGGCAGTGGCACAGGATCCTGCACTGGATTTGGCAGAACAAATGGCATAAGGGCTTCCATCGGTACAACCCAGGGAGAGATGGTGGTTGCAAAATTCTTACTTAGAAATGGCCCGAGTGGAACATATTCCCACTTTTGGATGTCTCTGGCACTCCAGTCATTCATCAGTACCATCCCGAAGATGTGCTCCTCAGCTTTATGAATTGGGATGGGGGGGTTCCCAACGAGTTTTCCTGAACCCCACAAGAAAAGCCATTTTCAATTCAATGGTCAAAAAGCTTTGCTGGCCTCAAATTCTTGGAAGCCTGGTCCATCCATTTGGGTCCAAACCCTGGGCCCAATTGGCCCCTATACCCACCTGGGAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAGAGAGGGGAAGAGCA